Incidental Mutation 'R6404:Slmap'
ID518911
Institutional Source Beutler Lab
Gene Symbol Slmap
Ensembl Gene ENSMUSG00000021870
Gene Namesarcolemma associated protein
SynonymsD330001L02Rik, Slap
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6404 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location26413168-26534931 bp(-) (GRCm38)
Type of Mutationsplice site (10 bp from exon)
DNA Base Change (assembly) T to A at 26422411 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000038522] [ENSMUST00000090359] [ENSMUST00000102956] [ENSMUST00000112330] [ENSMUST00000112331] [ENSMUST00000139075]
Predicted Effect probably null
Transcript: ENSMUST00000038522
SMART Domains Protein: ENSMUSP00000046956
Gene: ENSMUSG00000021870

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 390 N/A INTRINSIC
coiled coil region 486 568 N/A INTRINSIC
coiled coil region 595 794 N/A INTRINSIC
transmembrane domain 796 818 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000090359
SMART Domains Protein: ENSMUSP00000087836
Gene: ENSMUSG00000021870

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 390 N/A INTRINSIC
coiled coil region 490 572 N/A INTRINSIC
coiled coil region 599 799 N/A INTRINSIC
transmembrane domain 801 823 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102956
SMART Domains Protein: ENSMUSP00000100021
Gene: ENSMUSG00000021870

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 390 N/A INTRINSIC
coiled coil region 486 568 N/A INTRINSIC
coiled coil region 595 794 N/A INTRINSIC
transmembrane domain 796 818 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112330
SMART Domains Protein: ENSMUSP00000107949
Gene: ENSMUSG00000021870

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 383 N/A INTRINSIC
coiled coil region 452 534 N/A INTRINSIC
coiled coil region 561 761 N/A INTRINSIC
transmembrane domain 763 785 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112331
SMART Domains Protein: ENSMUSP00000107950
Gene: ENSMUSG00000021870

DomainStartEndE-ValueType
coiled coil region 46 78 N/A INTRINSIC
coiled coil region 109 260 N/A INTRINSIC
coiled coil region 352 434 N/A INTRINSIC
coiled coil region 461 661 N/A INTRINSIC
transmembrane domain 663 685 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136635
SMART Domains Protein: ENSMUSP00000114601
Gene: ENSMUSG00000021870

DomainStartEndE-ValueType
coiled coil region 57 112 N/A INTRINSIC
coiled coil region 139 271 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000139075
SMART Domains Protein: ENSMUSP00000117816
Gene: ENSMUSG00000021870

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 390 N/A INTRINSIC
coiled coil region 507 589 N/A INTRINSIC
coiled coil region 616 816 N/A INTRINSIC
transmembrane domain 818 840 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000142679
SMART Domains Protein: ENSMUSP00000123072
Gene: ENSMUSG00000021870

DomainStartEndE-ValueType
coiled coil region 1 52 N/A INTRINSIC
coiled coil region 97 179 N/A INTRINSIC
coiled coil region 206 405 N/A INTRINSIC
transmembrane domain 408 430 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000145738
SMART Domains Protein: ENSMUSP00000117276
Gene: ENSMUSG00000021870

DomainStartEndE-ValueType
coiled coil region 1 59 N/A INTRINSIC
coiled coil region 138 220 N/A INTRINSIC
coiled coil region 247 447 N/A INTRINSIC
transmembrane domain 450 472 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of a conserved striatin-interacting phosphatase and kinase complex. Striatin family complexes participate in a variety of cellular processes including signaling, cell cycle control, cell migration, Golgi assembly, and apoptosis. The protein encoded by this gene is a coiled-coil, tail-anchored membrane protein with a single C-terminal transmembrane domain that is posttranslationally inserted into membranes. Mutations in this gene are associated with Brugada syndrome, a cardiac channelopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous inactivation in this locus affects T cell development. Mice homozygous for a transposon induced allele exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,265,918 D1540G probably benign Het
Adamts7 A T 9: 90,180,456 probably null Het
Apol10a C A 15: 77,489,041 F292L probably benign Het
Atp13a4 A T 16: 29,471,901 Y243* probably null Het
Cc2d2a A G 5: 43,704,074 N660D possibly damaging Het
Ccdc57 T C 11: 120,894,712 T466A probably benign Het
Ccdc74a A T 16: 17,650,025 N249Y possibly damaging Het
Cd3e T A 9: 45,001,128 E106V probably damaging Het
Col4a1 G T 8: 11,207,409 probably null Het
Csmd2 T C 4: 128,521,950 Y2691H possibly damaging Het
Dmxl2 T C 9: 54,375,536 R2786G probably damaging Het
Dpyd A G 3: 119,265,957 T768A probably benign Het
Endou T A 15: 97,712,131 Q428L probably damaging Het
Fam13c T C 10: 70,448,816 probably null Het
Fam160a2 G A 7: 105,384,991 R478* probably null Het
Frmd5 G A 2: 121,549,218 R70* probably null Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm4131 T A 14: 62,481,149 R3* probably null Het
Habp4 A G 13: 64,182,186 T302A possibly damaging Het
Ift81 A T 5: 122,611,006 D27E probably damaging Het
Iqcf3 T C 9: 106,552,884 I107V probably benign Het
Iqgap2 A G 13: 95,729,477 I298T probably benign Het
Lilr4b A G 10: 51,485,729 D199G probably damaging Het
Lsm8 C T 6: 18,848,740 S3F possibly damaging Het
Meox1 T C 11: 101,878,656 E238G probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Neb T C 2: 52,207,725 Y901C probably damaging Het
Nfat5 A G 8: 107,370,588 M121V probably benign Het
Notch2 G A 3: 98,081,998 G278D probably damaging Het
Olfr1226 T C 2: 89,193,562 I157M probably damaging Het
Pbld2 T A 10: 63,054,328 S172T probably damaging Het
Pla2g7 T A 17: 43,594,797 Y83N probably damaging Het
Plxnb1 A T 9: 109,116,637 I2079F probably damaging Het
Rara T C 11: 98,961,013 F17L probably benign Het
Skint5 G A 4: 113,942,609 T121I probably damaging Het
Slco6c1 T C 1: 97,118,605 Y251C probably damaging Het
Uba2 A T 7: 34,154,560 L319Q probably damaging Het
Vmn2r96 A T 17: 18,597,531 I457F probably damaging Het
Zfp57 A T 17: 37,009,824 H190L probably damaging Het
Zfp738 A G 13: 67,671,060 S271P possibly damaging Het
Zp2 A T 7: 120,135,542 H474Q possibly damaging Het
Other mutations in Slmap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02402:Slmap APN 14 26463710 missense probably damaging 0.97
IGL02612:Slmap APN 14 26459466 splice site probably benign
IGL02630:Slmap APN 14 26422431 missense possibly damaging 0.93
IGL02798:Slmap APN 14 26470378 missense possibly damaging 0.88
PIT4382001:Slmap UTSW 14 26533431 missense probably damaging 1.00
R0433:Slmap UTSW 14 26453594 nonsense probably null
R0963:Slmap UTSW 14 26468520 missense probably damaging 1.00
R1721:Slmap UTSW 14 26460218 splice site probably benign
R1848:Slmap UTSW 14 26422574 missense probably benign
R2151:Slmap UTSW 14 26418247 missense probably damaging 1.00
R2152:Slmap UTSW 14 26418247 missense probably damaging 1.00
R2153:Slmap UTSW 14 26418247 missense probably damaging 1.00
R2154:Slmap UTSW 14 26418247 missense probably damaging 1.00
R3725:Slmap UTSW 14 26427242 missense probably damaging 0.99
R3726:Slmap UTSW 14 26427242 missense probably damaging 0.99
R3935:Slmap UTSW 14 26459415 missense probably benign
R4118:Slmap UTSW 14 26482872 missense probably damaging 0.99
R4594:Slmap UTSW 14 26465617 missense probably damaging 1.00
R4731:Slmap UTSW 14 26468535 missense probably damaging 0.97
R4732:Slmap UTSW 14 26468535 missense probably damaging 0.97
R4733:Slmap UTSW 14 26468535 missense probably damaging 0.97
R4817:Slmap UTSW 14 26462352 missense probably damaging 0.97
R4847:Slmap UTSW 14 26426608 missense possibly damaging 0.90
R4860:Slmap UTSW 14 26460209 missense probably benign 0.22
R4860:Slmap UTSW 14 26460209 missense probably benign 0.22
R5092:Slmap UTSW 14 26463589 missense probably damaging 1.00
R5211:Slmap UTSW 14 26482962 missense probably damaging 1.00
R5387:Slmap UTSW 14 26459933 missense probably benign 0.22
R5821:Slmap UTSW 14 26462280 missense probably damaging 1.00
R6856:Slmap UTSW 14 26430092 intron probably null
R6977:Slmap UTSW 14 26533419 missense probably damaging 1.00
R7108:Slmap UTSW 14 26422521 missense probably benign 0.04
R7320:Slmap UTSW 14 26460072 missense possibly damaging 0.53
R7470:Slmap UTSW 14 26427420 missense probably benign
R7520:Slmap UTSW 14 26427420 missense probably benign
R7540:Slmap UTSW 14 26460191 missense probably damaging 0.99
R7544:Slmap UTSW 14 26429846 missense probably damaging 0.99
R7544:Slmap UTSW 14 26429848 missense probably damaging 0.99
Z1177:Slmap UTSW 14 26533450 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACAGACCAGGCTTCTGCTAC -3'
(R):5'- GTTCTCAGAAGCAGAGTTTTGAAC -3'

Sequencing Primer
(F):5'- TGCCAACTGACGGGTAAT -3'
(R):5'- GTTTTGAACTCACGAGTGACCTCAG -3'
Posted On2018-05-24