Incidental Mutation 'R6404:Vmn2r96'
ID518917
Institutional Source Beutler Lab
Gene Symbol Vmn2r96
Ensembl Gene ENSMUSG00000091679
Gene Namevomeronasal 2, receptor 96
SynonymsEG433070
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R6404 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location18573151-18616003 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18597531 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 457 (I457F)
Ref Sequence ENSEMBL: ENSMUSP00000131564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165692] [ENSMUST00000177244] [ENSMUST00000231261] [ENSMUST00000231286]
Predicted Effect probably damaging
Transcript: ENSMUST00000165692
AA Change: I457F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131564
Gene: ENSMUSG00000091679
AA Change: I457F

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 257 8.6e-20 PFAM
Pfam:NCD3G 317 370 3.7e-22 PFAM
Pfam:7tm_3 402 638 3.9e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177244
AA Change: I649F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135095
Gene: ENSMUSG00000091679
AA Change: I649F

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 245 4.2e-19 PFAM
Pfam:NCD3G 317 370 6.9e-21 PFAM
Pfam:7tm_3 400 639 3.4e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231261
Predicted Effect probably damaging
Transcript: ENSMUST00000231286
AA Change: I649F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,265,918 D1540G probably benign Het
Adamts7 A T 9: 90,180,456 probably null Het
Apol10a C A 15: 77,489,041 F292L probably benign Het
Atp13a4 A T 16: 29,471,901 Y243* probably null Het
Cc2d2a A G 5: 43,704,074 N660D possibly damaging Het
Ccdc57 T C 11: 120,894,712 T466A probably benign Het
Ccdc74a A T 16: 17,650,025 N249Y possibly damaging Het
Cd3e T A 9: 45,001,128 E106V probably damaging Het
Col4a1 G T 8: 11,207,409 probably null Het
Csmd2 T C 4: 128,521,950 Y2691H possibly damaging Het
Dmxl2 T C 9: 54,375,536 R2786G probably damaging Het
Dpyd A G 3: 119,265,957 T768A probably benign Het
Endou T A 15: 97,712,131 Q428L probably damaging Het
Fam13c T C 10: 70,448,816 probably null Het
Fam160a2 G A 7: 105,384,991 R478* probably null Het
Frmd5 G A 2: 121,549,218 R70* probably null Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm4131 T A 14: 62,481,149 R3* probably null Het
Habp4 A G 13: 64,182,186 T302A possibly damaging Het
Ift81 A T 5: 122,611,006 D27E probably damaging Het
Iqcf3 T C 9: 106,552,884 I107V probably benign Het
Iqgap2 A G 13: 95,729,477 I298T probably benign Het
Lilr4b A G 10: 51,485,729 D199G probably damaging Het
Lsm8 C T 6: 18,848,740 S3F possibly damaging Het
Meox1 T C 11: 101,878,656 E238G probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Neb T C 2: 52,207,725 Y901C probably damaging Het
Nfat5 A G 8: 107,370,588 M121V probably benign Het
Notch2 G A 3: 98,081,998 G278D probably damaging Het
Olfr1226 T C 2: 89,193,562 I157M probably damaging Het
Pbld2 T A 10: 63,054,328 S172T probably damaging Het
Pla2g7 T A 17: 43,594,797 Y83N probably damaging Het
Plxnb1 A T 9: 109,116,637 I2079F probably damaging Het
Rara T C 11: 98,961,013 F17L probably benign Het
Skint5 G A 4: 113,942,609 T121I probably damaging Het
Slco6c1 T C 1: 97,118,605 Y251C probably damaging Het
Slmap T A 14: 26,422,411 probably null Het
Uba2 A T 7: 34,154,560 L319Q probably damaging Het
Zfp57 A T 17: 37,009,824 H190L probably damaging Het
Zfp738 A G 13: 67,671,060 S271P possibly damaging Het
Zp2 A T 7: 120,135,542 H474Q possibly damaging Het
Other mutations in Vmn2r96
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Vmn2r96 APN 17 18583815 missense probably benign 0.00
IGL00563:Vmn2r96 APN 17 18583815 missense probably benign 0.00
IGL00769:Vmn2r96 APN 17 18583819 missense probably benign 0.00
IGL01314:Vmn2r96 APN 17 18582964 missense probably benign 0.00
IGL01983:Vmn2r96 APN 17 18597265 missense probably damaging 0.99
IGL02314:Vmn2r96 APN 17 18583959 missense probably benign 0.01
IGL02600:Vmn2r96 APN 17 18597567 missense probably benign
IGL02672:Vmn2r96 APN 17 18598114 missense probably benign 0.02
IGL02750:Vmn2r96 APN 17 18582589 missense probably benign 0.01
IGL03068:Vmn2r96 APN 17 18582875 missense probably benign 0.00
IGL03411:Vmn2r96 APN 17 18586372 missense possibly damaging 0.88
R0316:Vmn2r96 UTSW 17 18582565 missense probably damaging 1.00
R0502:Vmn2r96 UTSW 17 18584000 missense probably benign
R0580:Vmn2r96 UTSW 17 18582638 missense probably damaging 1.00
R0652:Vmn2r96 UTSW 17 18597568 missense probably benign 0.05
R0789:Vmn2r96 UTSW 17 18582476 missense possibly damaging 0.81
R1462:Vmn2r96 UTSW 17 18597398 missense possibly damaging 0.94
R1462:Vmn2r96 UTSW 17 18597398 missense possibly damaging 0.94
R1660:Vmn2r96 UTSW 17 18597726 missense probably benign 0.00
R1755:Vmn2r96 UTSW 17 18582653 missense possibly damaging 0.50
R1843:Vmn2r96 UTSW 17 18597921 missense probably benign 0.14
R1943:Vmn2r96 UTSW 17 18586402 missense probably benign 0.09
R1993:Vmn2r96 UTSW 17 18583876 missense probably damaging 1.00
R2018:Vmn2r96 UTSW 17 18584001 missense probably benign
R2405:Vmn2r96 UTSW 17 18597840 missense probably damaging 0.96
R3977:Vmn2r96 UTSW 17 18597679 missense probably damaging 1.00
R3979:Vmn2r96 UTSW 17 18597679 missense probably damaging 1.00
R4059:Vmn2r96 UTSW 17 18598077 missense probably benign 0.20
R4693:Vmn2r96 UTSW 17 18583008 missense probably benign 0.03
R4709:Vmn2r96 UTSW 17 18582826 missense probably benign 0.36
R4776:Vmn2r96 UTSW 17 18597508 missense probably damaging 1.00
R4882:Vmn2r96 UTSW 17 18597604 missense probably damaging 1.00
R4920:Vmn2r96 UTSW 17 18582656 missense probably benign 0.07
R5143:Vmn2r96 UTSW 17 18583858 missense possibly damaging 0.65
R5301:Vmn2r96 UTSW 17 18597688 missense probably damaging 0.98
R5507:Vmn2r96 UTSW 17 18597829 missense probably damaging 1.00
R6151:Vmn2r96 UTSW 17 18583959 missense probably benign 0.01
R6181:Vmn2r96 UTSW 17 18583864 missense probably benign
R6339:Vmn2r96 UTSW 17 18583862 missense possibly damaging 0.84
R6452:Vmn2r96 UTSW 17 18583855 missense probably benign 0.07
R6749:Vmn2r96 UTSW 17 18598090 missense probably damaging 0.99
R6813:Vmn2r96 UTSW 17 18581854 missense probably benign 0.04
R6851:Vmn2r96 UTSW 17 18582538 missense possibly damaging 0.95
R6944:Vmn2r96 UTSW 17 18597629 missense probably benign 0.16
R6949:Vmn2r96 UTSW 17 18597838 missense probably damaging 1.00
R6962:Vmn2r96 UTSW 17 18598021 missense probably damaging 0.99
R6990:Vmn2r96 UTSW 17 18583820 missense probably benign
R7149:Vmn2r96 UTSW 17 18597727 missense possibly damaging 0.89
R7346:Vmn2r96 UTSW 17 18582767 missense probably benign 0.15
R7385:Vmn2r96 UTSW 17 18583040 missense probably damaging 1.00
R7442:Vmn2r96 UTSW 17 18573400 missense probably benign 0.02
R7509:Vmn2r96 UTSW 17 18582733 missense probably benign 0.02
R7652:Vmn2r96 UTSW 17 18573570 missense probably benign
R7659:Vmn2r96 UTSW 17 18573487 missense probably benign 0.00
R7753:Vmn2r96 UTSW 17 18586401 missense possibly damaging 0.46
R7855:Vmn2r96 UTSW 17 18597868 missense possibly damaging 0.59
R7938:Vmn2r96 UTSW 17 18597868 missense possibly damaging 0.59
Z1088:Vmn2r96 UTSW 17 18597366 missense possibly damaging 0.86
Z1177:Vmn2r96 UTSW 17 18598114 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGAAGACACCTTGGGGATGG -3'
(R):5'- GATGTTGCCATCCATATTCCAC -3'

Sequencing Primer
(F):5'- ACACCTTGGGGATGGCATTAGC -3'
(R):5'- TTCCACAAATAAGAAGTTGGATCAGG -3'
Posted On2018-05-24