Incidental Mutation 'R6439:Olfr1317'
ID518927
Institutional Source Beutler Lab
Gene Symbol Olfr1317
Ensembl Gene ENSMUSG00000050776
Gene Nameolfactory receptor 1317
SynonymsGA_x6K02T2Q125-73188162-73189112, MOR245-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6439 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location112140329-112144054 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112142164 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 73 (V73A)
Ref Sequence ENSEMBL: ENSMUSP00000149091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060098] [ENSMUST00000214801] [ENSMUST00000216988]
Predicted Effect probably benign
Transcript: ENSMUST00000060098
AA Change: V73A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000058587
Gene: ENSMUSG00000050776
AA Change: V73A

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 5.1e-40 PFAM
Pfam:7tm_1 41 287 5.2e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213693
Predicted Effect probably benign
Transcript: ENSMUST00000214801
AA Change: V73A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000216988
AA Change: V73A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik T C 15: 58,032,048 D18G probably null Het
A530064D06Rik A G 17: 48,166,485 V88A probably damaging Het
Abhd6 T C 14: 8,055,589 L272P probably damaging Het
Adam25 C T 8: 40,754,590 R298C possibly damaging Het
Afap1l2 T C 19: 56,928,386 N219D possibly damaging Het
Brd3 A G 2: 27,463,926 F58S probably damaging Het
Ceacam3 G A 7: 17,158,328 R332H possibly damaging Het
Cfap57 C A 4: 118,588,975 probably null Het
Chd2 A G 7: 73,480,406 F834L probably damaging Het
Crocc2 A G 1: 93,183,404 K140E possibly damaging Het
Fam117b A G 1: 59,981,572 T534A probably benign Het
Fchsd1 C T 18: 37,969,434 V14I probably damaging Het
Gm5346 T C 8: 43,625,951 N412S probably damaging Het
Grid2ip A T 5: 143,373,502 E291V probably damaging Het
Hbp1 A G 12: 31,937,721 L146S probably damaging Het
Hr A G 14: 70,561,836 D616G possibly damaging Het
Igfbp5 A C 1: 72,863,141 probably null Het
Jak2 C T 19: 29,309,622 probably null Het
Mpl T C 4: 118,448,553 D425G probably damaging Het
Ms4a4c T C 19: 11,421,312 S165P probably benign Het
Mycbp2 A G 14: 103,155,475 S3217P probably benign Het
Nfatc3 T A 8: 106,083,870 L426* probably null Het
Olfr8 T A 10: 78,955,984 Y260N probably damaging Het
Olfr994 T C 2: 85,430,724 Y35C probably damaging Het
Phf1 G T 17: 26,936,612 V384L probably benign Het
Rangap1 T C 15: 81,712,135 T259A probably benign Het
Rec8 A G 14: 55,618,619 N6S possibly damaging Het
Rmdn2 G A 17: 79,627,542 probably benign Het
Scin T C 12: 40,068,946 Y617C probably damaging Het
Ttc13 T C 8: 124,673,482 S744G probably benign Het
Ttc14 T C 3: 33,808,819 probably benign Het
Uggt1 T C 1: 36,174,951 E219G possibly damaging Het
Vmn1r183 A G 7: 24,055,279 D169G possibly damaging Het
Vmn1r72 A T 7: 11,679,137 probably null Het
Zfp326 T G 5: 105,888,718 M76R probably null Het
Other mutations in Olfr1317
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03294:Olfr1317 APN 2 112142173 missense probably benign 0.12
R1390:Olfr1317 UTSW 2 112142607 missense probably benign 0.35
R1404:Olfr1317 UTSW 2 112142623 missense probably benign 0.01
R1404:Olfr1317 UTSW 2 112142623 missense probably benign 0.01
R1771:Olfr1317 UTSW 2 112142720 nonsense probably null
R3500:Olfr1317 UTSW 2 112142127 missense possibly damaging 0.64
R3894:Olfr1317 UTSW 2 112142014 missense probably benign 0.04
R4289:Olfr1317 UTSW 2 112141974 missense probably benign 0.28
R5646:Olfr1317 UTSW 2 112142683 missense possibly damaging 0.95
R6336:Olfr1317 UTSW 2 112142406 missense probably benign 0.10
R6450:Olfr1317 UTSW 2 112142380 nonsense probably null
R6737:Olfr1317 UTSW 2 112142203 missense probably damaging 1.00
R7269:Olfr1317 UTSW 2 112142560 missense probably damaging 1.00
R7336:Olfr1317 UTSW 2 112142169 missense possibly damaging 0.80
R7597:Olfr1317 UTSW 2 112142580 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTTGCACAAGTTGATGGATGG -3'
(R):5'- GGGCTTACAGATAGCAATGTACC -3'

Sequencing Primer
(F):5'- TGGAGGAAATCACTCAGTGGTATC -3'
(R):5'- ACAGATAGCAATGTACCTGTCATAG -3'
Posted On2018-05-24