Incidental Mutation 'R6439:Zfp326'
ID518931
Institutional Source Beutler Lab
Gene Symbol Zfp326
Ensembl Gene ENSMUSG00000029290
Gene Namezinc finger protein 326
Synonyms5730470H14Rik, ZAN75
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R6439 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location105876565-105915818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 105888718 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 76 (M76R)
Ref Sequence ENSEMBL: ENSMUSP00000118976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031227] [ENSMUST00000138615] [ENSMUST00000150440]
Predicted Effect probably damaging
Transcript: ENSMUST00000031227
AA Change: M165R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031227
Gene: ENSMUSG00000029290
AA Change: M165R

DomainStartEndE-ValueType
internal_repeat_1 19 39 1.09e-7 PROSPERO
internal_repeat_1 31 58 1.09e-7 PROSPERO
low complexity region 63 69 N/A INTRINSIC
low complexity region 154 162 N/A INTRINSIC
low complexity region 194 205 N/A INTRINSIC
coiled coil region 277 304 N/A INTRINSIC
ZnF_C2H2 312 336 4.12e0 SMART
ZnF_C2H2 405 430 1.78e2 SMART
low complexity region 483 561 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133155
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136558
Predicted Effect probably benign
Transcript: ENSMUST00000138615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150109
Predicted Effect probably null
Transcript: ENSMUST00000150440
AA Change: M76R

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118976
Gene: ENSMUSG00000029290
AA Change: M76R

DomainStartEndE-ValueType
internal_repeat_1 19 39 2.38e-7 PROSPERO
internal_repeat_1 31 58 2.38e-7 PROSPERO
low complexity region 63 73 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
coiled coil region 188 215 N/A INTRINSIC
ZnF_C2H2 223 247 4.12e0 SMART
ZnF_C2H2 316 341 1.78e2 SMART
low complexity region 389 415 N/A INTRINSIC
Meta Mutation Damage Score 0.1716 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik T C 15: 58,032,048 D18G probably null Het
A530064D06Rik A G 17: 48,166,485 V88A probably damaging Het
Abhd6 T C 14: 8,055,589 L272P probably damaging Het
Adam25 C T 8: 40,754,590 R298C possibly damaging Het
Afap1l2 T C 19: 56,928,386 N219D possibly damaging Het
Brd3 A G 2: 27,463,926 F58S probably damaging Het
Ceacam3 G A 7: 17,158,328 R332H possibly damaging Het
Cfap57 C A 4: 118,588,975 probably null Het
Chd2 A G 7: 73,480,406 F834L probably damaging Het
Crocc2 A G 1: 93,183,404 K140E possibly damaging Het
Fam117b A G 1: 59,981,572 T534A probably benign Het
Fchsd1 C T 18: 37,969,434 V14I probably damaging Het
Gm5346 T C 8: 43,625,951 N412S probably damaging Het
Grid2ip A T 5: 143,373,502 E291V probably damaging Het
Hbp1 A G 12: 31,937,721 L146S probably damaging Het
Hr A G 14: 70,561,836 D616G possibly damaging Het
Igfbp5 A C 1: 72,863,141 probably null Het
Jak2 C T 19: 29,309,622 probably null Het
Mpl T C 4: 118,448,553 D425G probably damaging Het
Ms4a4c T C 19: 11,421,312 S165P probably benign Het
Mycbp2 A G 14: 103,155,475 S3217P probably benign Het
Nfatc3 T A 8: 106,083,870 L426* probably null Het
Olfr1317 T C 2: 112,142,164 V73A probably benign Het
Olfr8 T A 10: 78,955,984 Y260N probably damaging Het
Olfr994 T C 2: 85,430,724 Y35C probably damaging Het
Phf1 G T 17: 26,936,612 V384L probably benign Het
Rangap1 T C 15: 81,712,135 T259A probably benign Het
Rec8 A G 14: 55,618,619 N6S possibly damaging Het
Rmdn2 G A 17: 79,627,542 probably benign Het
Scin T C 12: 40,068,946 Y617C probably damaging Het
Ttc13 T C 8: 124,673,482 S744G probably benign Het
Ttc14 T C 3: 33,808,819 probably benign Het
Uggt1 T C 1: 36,174,951 E219G possibly damaging Het
Vmn1r183 A G 7: 24,055,279 D169G possibly damaging Het
Vmn1r72 A T 7: 11,679,137 probably null Het
Other mutations in Zfp326
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Zfp326 APN 5 105907045 missense possibly damaging 0.89
IGL00432:Zfp326 APN 5 105896533 missense probably damaging 0.98
IGL01551:Zfp326 APN 5 105888585 missense probably damaging 1.00
IGL03197:Zfp326 APN 5 105891193 missense probably benign 0.00
PIT4508001:Zfp326 UTSW 5 105914690 missense probably benign 0.02
R0326:Zfp326 UTSW 5 105910275 missense probably damaging 1.00
R0411:Zfp326 UTSW 5 105878775 missense possibly damaging 0.81
R0634:Zfp326 UTSW 5 105886203 nonsense probably null
R0850:Zfp326 UTSW 5 105878797 splice site probably null
R1833:Zfp326 UTSW 5 105891169 nonsense probably null
R2108:Zfp326 UTSW 5 105914780 utr 3 prime probably benign
R2857:Zfp326 UTSW 5 105888529 missense probably benign 0.11
R3702:Zfp326 UTSW 5 105888843 splice site probably null
R4690:Zfp326 UTSW 5 105907076 missense probably damaging 1.00
R5614:Zfp326 UTSW 5 105888495 missense probably damaging 1.00
R6212:Zfp326 UTSW 5 105910231 missense probably damaging 1.00
R6262:Zfp326 UTSW 5 105888487 missense probably damaging 1.00
R6274:Zfp326 UTSW 5 105905980 missense probably damaging 1.00
R6963:Zfp326 UTSW 5 105911493 nonsense probably null
Z1088:Zfp326 UTSW 5 105888630 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGATTTGAGAGCTCCTACCG -3'
(R):5'- TGGGAAACTTTTGCAGCCAAC -3'

Sequencing Primer
(F):5'- TTTGAGAGCTCCTACCGGAATAGC -3'
(R):5'- CTCGTTGAAAACATGGTCTTGAAAGG -3'
Posted On2018-05-24