Incidental Mutation 'R6439:Vmn1r72'
ID518933
Institutional Source Beutler Lab
Gene Symbol Vmn1r72
Ensembl Gene ENSMUSG00000095430
Gene Namevomeronasal 1 receptor 72
SynonymsV1rg1
MMRRC Submission
Accession Numbers

Genbank: NM_145843; MGI: 2182256

Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6439 (G1)
Quality Score191.009
Status Validated
Chromosome7
Chromosomal Location11664479-11680147 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 11679137 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148081 (fasta)
Predicted Effect probably null
Transcript: ENSMUST00000209638
Predicted Effect probably benign
Transcript: ENSMUST00000227010
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik T C 15: 58,032,048 D18G probably null Het
A530064D06Rik A G 17: 48,166,485 V88A probably damaging Het
Abhd6 T C 14: 8,055,589 L272P probably damaging Het
Adam25 C T 8: 40,754,590 R298C possibly damaging Het
Afap1l2 T C 19: 56,928,386 N219D possibly damaging Het
Brd3 A G 2: 27,463,926 F58S probably damaging Het
Ceacam3 G A 7: 17,158,328 R332H possibly damaging Het
Cfap57 C A 4: 118,588,975 probably null Het
Chd2 A G 7: 73,480,406 F834L probably damaging Het
Crocc2 A G 1: 93,183,404 K140E possibly damaging Het
Fam117b A G 1: 59,981,572 T534A probably benign Het
Fchsd1 C T 18: 37,969,434 V14I probably damaging Het
Gm5346 T C 8: 43,625,951 N412S probably damaging Het
Grid2ip A T 5: 143,373,502 E291V probably damaging Het
Hbp1 A G 12: 31,937,721 L146S probably damaging Het
Hr A G 14: 70,561,836 D616G possibly damaging Het
Igfbp5 A C 1: 72,863,141 probably null Het
Jak2 C T 19: 29,309,622 probably null Het
Mpl T C 4: 118,448,553 D425G probably damaging Het
Ms4a4c T C 19: 11,421,312 S165P probably benign Het
Mycbp2 A G 14: 103,155,475 S3217P probably benign Het
Nfatc3 T A 8: 106,083,870 L426* probably null Het
Olfr1317 T C 2: 112,142,164 V73A probably benign Het
Olfr8 T A 10: 78,955,984 Y260N probably damaging Het
Olfr994 T C 2: 85,430,724 Y35C probably damaging Het
Phf1 G T 17: 26,936,612 V384L probably benign Het
Rangap1 T C 15: 81,712,135 T259A probably benign Het
Rec8 A G 14: 55,618,619 N6S possibly damaging Het
Rmdn2 G A 17: 79,627,542 probably benign Het
Scin T C 12: 40,068,946 Y617C probably damaging Het
Ttc13 T C 8: 124,673,482 S744G probably benign Het
Ttc14 T C 3: 33,808,819 probably benign Het
Uggt1 T C 1: 36,174,951 E219G possibly damaging Het
Vmn1r183 A G 7: 24,055,279 D169G possibly damaging Het
Zfp326 T G 5: 105,888,718 M76R probably null Het
Other mutations in Vmn1r72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Vmn1r72 APN 7 11670497 missense probably benign 0.41
IGL02375:Vmn1r72 APN 7 11669745 missense probably benign 0.10
IGL02809:Vmn1r72 APN 7 11670003 missense probably benign 0.03
IGL03104:Vmn1r72 APN 7 11669885 missense probably damaging 1.00
3-1:Vmn1r72 UTSW 7 11669898 missense probably damaging 0.97
IGL03014:Vmn1r72 UTSW 7 11669784 missense possibly damaging 0.80
R0346:Vmn1r72 UTSW 7 11669694 missense probably benign
R0524:Vmn1r72 UTSW 7 11669792 missense probably benign 0.32
R1951:Vmn1r72 UTSW 7 11669804 missense probably damaging 1.00
R1953:Vmn1r72 UTSW 7 11669804 missense probably damaging 1.00
R2181:Vmn1r72 UTSW 7 11669668 nonsense probably null
R4182:Vmn1r72 UTSW 7 11670068 missense probably benign 0.00
R4345:Vmn1r72 UTSW 7 11670036 missense possibly damaging 0.86
R4496:Vmn1r72 UTSW 7 11669864 missense probably damaging 1.00
R4999:Vmn1r72 UTSW 7 11670373 missense possibly damaging 0.63
R5401:Vmn1r72 UTSW 7 11669916 missense probably damaging 1.00
R5700:Vmn1r72 UTSW 7 11670423 missense probably damaging 0.98
R5754:Vmn1r72 UTSW 7 11669849 missense probably damaging 0.99
R6292:Vmn1r72 UTSW 7 11669652 missense probably benign 0.02
R7616:Vmn1r72 UTSW 7 11670345 missense probably damaging 0.96
R7629:Vmn1r72 UTSW 7 11669784 missense probably benign
X0063:Vmn1r72 UTSW 7 11669712 missense probably benign 0.00
Z1088:Vmn1r72 UTSW 7 11670173 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTTCGCACTTCATAAACAATTCCTG -3'
(R):5'- GCAGAGACTCACTTCTCATCG -3'

Sequencing Primer
(F):5'- GCACTTCATAAACAATTCCTGAATGC -3'
(R):5'- CTCATCGTGACAGGTATAACCATGG -3'
Posted On2018-05-24