Incidental Mutation 'R6439:Vmn1r183'
ID518935
Institutional Source Beutler Lab
Gene Symbol Vmn1r183
Ensembl Gene ENSMUSG00000066723
Gene Namevomeronasal 1 receptor 183
SynonymsLOC209824, V1rd15
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R6439 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location24054774-24055691 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24055279 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 169 (D169G)
Ref Sequence ENSEMBL: ENSMUSP00000083176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086012]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086012
AA Change: D169G

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000083176
Gene: ENSMUSG00000066723
AA Change: D169G

DomainStartEndE-ValueType
Pfam:TAS2R 8 297 5.6e-15 PFAM
Pfam:7tm_1 31 285 1.4e-9 PFAM
Pfam:V1R 41 296 2.5e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205855
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik T C 15: 58,032,048 D18G probably null Het
A530064D06Rik A G 17: 48,166,485 V88A probably damaging Het
Abhd6 T C 14: 8,055,589 L272P probably damaging Het
Adam25 C T 8: 40,754,590 R298C possibly damaging Het
Afap1l2 T C 19: 56,928,386 N219D possibly damaging Het
Brd3 A G 2: 27,463,926 F58S probably damaging Het
Ceacam3 G A 7: 17,158,328 R332H possibly damaging Het
Cfap57 C A 4: 118,588,975 probably null Het
Chd2 A G 7: 73,480,406 F834L probably damaging Het
Crocc2 A G 1: 93,183,404 K140E possibly damaging Het
Fam117b A G 1: 59,981,572 T534A probably benign Het
Fchsd1 C T 18: 37,969,434 V14I probably damaging Het
Gm5346 T C 8: 43,625,951 N412S probably damaging Het
Grid2ip A T 5: 143,373,502 E291V probably damaging Het
Hbp1 A G 12: 31,937,721 L146S probably damaging Het
Hr A G 14: 70,561,836 D616G possibly damaging Het
Igfbp5 A C 1: 72,863,141 probably null Het
Jak2 C T 19: 29,309,622 probably null Het
Mpl T C 4: 118,448,553 D425G probably damaging Het
Ms4a4c T C 19: 11,421,312 S165P probably benign Het
Mycbp2 A G 14: 103,155,475 S3217P probably benign Het
Nfatc3 T A 8: 106,083,870 L426* probably null Het
Olfr1317 T C 2: 112,142,164 V73A probably benign Het
Olfr8 T A 10: 78,955,984 Y260N probably damaging Het
Olfr994 T C 2: 85,430,724 Y35C probably damaging Het
Phf1 G T 17: 26,936,612 V384L probably benign Het
Rangap1 T C 15: 81,712,135 T259A probably benign Het
Rec8 A G 14: 55,618,619 N6S possibly damaging Het
Rmdn2 G A 17: 79,627,542 probably benign Het
Scin T C 12: 40,068,946 Y617C probably damaging Het
Ttc13 T C 8: 124,673,482 S744G probably benign Het
Ttc14 T C 3: 33,808,819 probably benign Het
Uggt1 T C 1: 36,174,951 E219G possibly damaging Het
Vmn1r72 A T 7: 11,679,137 probably null Het
Zfp326 T G 5: 105,888,718 M76R probably null Het
Other mutations in Vmn1r183
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Vmn1r183 APN 7 24055224 missense probably damaging 1.00
IGL01813:Vmn1r183 APN 7 24055560 missense probably benign 0.19
IGL03377:Vmn1r183 APN 7 24055392 missense possibly damaging 0.70
PIT4791001:Vmn1r183 UTSW 7 24054841 missense probably damaging 0.99
R0463:Vmn1r183 UTSW 7 24055501 missense probably damaging 1.00
R0616:Vmn1r183 UTSW 7 24054825 missense probably benign 0.03
R0666:Vmn1r183 UTSW 7 24055176 missense probably benign
R3928:Vmn1r183 UTSW 7 24055572 missense probably damaging 0.98
R4425:Vmn1r183 UTSW 7 24055548 missense probably benign 0.00
R4767:Vmn1r183 UTSW 7 24055106 frame shift probably null
R4835:Vmn1r183 UTSW 7 24055139 missense probably benign 0.07
R5267:Vmn1r183 UTSW 7 24055546 missense possibly damaging 0.90
R5693:Vmn1r183 UTSW 7 24054802 missense possibly damaging 0.94
R6291:Vmn1r183 UTSW 7 24055557 missense possibly damaging 0.70
R7073:Vmn1r183 UTSW 7 24055501 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTCCACCTGTGTCCTGAG -3'
(R):5'- TTGGTTGCTCTGGACTCAGC -3'

Sequencing Primer
(F):5'- ACCTGTGTCCTGAGTATCCATCAG -3'
(R):5'- TGGACTCAGCTTGGCCTCTG -3'
Posted On2018-05-24