Incidental Mutation 'R6439:Gm5346'
ID518938
Institutional Source Beutler Lab
Gene Symbol Gm5346
Ensembl Gene ENSMUSG00000050190
Gene Namepredicted gene 5346
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6439 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location43624951-43627276 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43625951 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 412 (N412S)
Ref Sequence ENSEMBL: ENSMUSP00000058858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056023]
Predicted Effect probably damaging
Transcript: ENSMUST00000056023
AA Change: N412S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058858
Gene: ENSMUSG00000050190
AA Change: N412S

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 159 1.3e-18 PFAM
Pfam:Reprolysin_5 205 384 1.1e-15 PFAM
Pfam:Reprolysin_4 205 393 6.2e-9 PFAM
Pfam:Reprolysin 207 397 1.7e-46 PFAM
Pfam:Reprolysin_2 223 389 5.7e-14 PFAM
Pfam:Reprolysin_3 231 352 2.6e-13 PFAM
DISIN 416 491 2.48e-38 SMART
ACR 492 628 3.4e-65 SMART
EGF 634 664 2.69e1 SMART
transmembrane domain 685 707 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik T C 15: 58,032,048 D18G probably null Het
A530064D06Rik A G 17: 48,166,485 V88A probably damaging Het
Abhd6 T C 14: 8,055,589 L272P probably damaging Het
Adam25 C T 8: 40,754,590 R298C possibly damaging Het
Afap1l2 T C 19: 56,928,386 N219D possibly damaging Het
Brd3 A G 2: 27,463,926 F58S probably damaging Het
Ceacam3 G A 7: 17,158,328 R332H possibly damaging Het
Cfap57 C A 4: 118,588,975 probably null Het
Chd2 A G 7: 73,480,406 F834L probably damaging Het
Crocc2 A G 1: 93,183,404 K140E possibly damaging Het
Fam117b A G 1: 59,981,572 T534A probably benign Het
Fchsd1 C T 18: 37,969,434 V14I probably damaging Het
Grid2ip A T 5: 143,373,502 E291V probably damaging Het
Hbp1 A G 12: 31,937,721 L146S probably damaging Het
Hr A G 14: 70,561,836 D616G possibly damaging Het
Igfbp5 A C 1: 72,863,141 probably null Het
Jak2 C T 19: 29,309,622 probably null Het
Mpl T C 4: 118,448,553 D425G probably damaging Het
Ms4a4c T C 19: 11,421,312 S165P probably benign Het
Mycbp2 A G 14: 103,155,475 S3217P probably benign Het
Nfatc3 T A 8: 106,083,870 L426* probably null Het
Olfr1317 T C 2: 112,142,164 V73A probably benign Het
Olfr8 T A 10: 78,955,984 Y260N probably damaging Het
Olfr994 T C 2: 85,430,724 Y35C probably damaging Het
Phf1 G T 17: 26,936,612 V384L probably benign Het
Rangap1 T C 15: 81,712,135 T259A probably benign Het
Rec8 A G 14: 55,618,619 N6S possibly damaging Het
Rmdn2 G A 17: 79,627,542 probably benign Het
Scin T C 12: 40,068,946 Y617C probably damaging Het
Ttc13 T C 8: 124,673,482 S744G probably benign Het
Ttc14 T C 3: 33,808,819 probably benign Het
Uggt1 T C 1: 36,174,951 E219G possibly damaging Het
Vmn1r183 A G 7: 24,055,279 D169G possibly damaging Het
Vmn1r72 A T 7: 11,679,137 probably null Het
Zfp326 T G 5: 105,888,718 M76R probably null Het
Other mutations in Gm5346
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Gm5346 APN 8 43625381 missense probably benign 0.12
IGL00391:Gm5346 APN 8 43625629 missense probably damaging 1.00
IGL00422:Gm5346 APN 8 43626351 missense probably damaging 1.00
IGL00664:Gm5346 APN 8 43625969 missense probably benign
IGL01095:Gm5346 APN 8 43626096 missense probably benign 0.22
IGL01113:Gm5346 APN 8 43626152 missense probably damaging 1.00
IGL01444:Gm5346 APN 8 43626433 missense probably benign 0.06
IGL01782:Gm5346 APN 8 43626735 missense probably benign 0.01
IGL01921:Gm5346 APN 8 43625511 missense probably damaging 0.96
IGL01964:Gm5346 APN 8 43626761 missense probably benign 0.00
IGL02139:Gm5346 APN 8 43625578 missense probably benign 0.01
IGL02555:Gm5346 APN 8 43625268 missense probably damaging 1.00
IGL02951:Gm5346 APN 8 43627088 missense possibly damaging 0.62
R0056:Gm5346 UTSW 8 43625503 nonsense probably null
R0218:Gm5346 UTSW 8 43626440 missense probably benign 0.00
R0530:Gm5346 UTSW 8 43626531 missense probably benign 0.00
R0925:Gm5346 UTSW 8 43626303 missense probably benign 0.11
R0927:Gm5346 UTSW 8 43625123 missense probably benign 0.00
R0975:Gm5346 UTSW 8 43625118 missense probably benign
R1300:Gm5346 UTSW 8 43626844 nonsense probably null
R1728:Gm5346 UTSW 8 43625583 missense probably damaging 1.00
R1729:Gm5346 UTSW 8 43625583 missense probably damaging 1.00
R1801:Gm5346 UTSW 8 43625917 nonsense probably null
R1869:Gm5346 UTSW 8 43625095 nonsense probably null
R1870:Gm5346 UTSW 8 43625095 nonsense probably null
R1871:Gm5346 UTSW 8 43625095 nonsense probably null
R1992:Gm5346 UTSW 8 43627139 missense probably benign 0.44
R2008:Gm5346 UTSW 8 43627037 missense probably benign 0.00
R2013:Gm5346 UTSW 8 43626405 missense possibly damaging 0.81
R2022:Gm5346 UTSW 8 43625917 nonsense probably null
R2175:Gm5346 UTSW 8 43625438 missense probably benign
R2875:Gm5346 UTSW 8 43627140 nonsense probably null
R3406:Gm5346 UTSW 8 43626052 nonsense probably null
R3845:Gm5346 UTSW 8 43626632 missense probably benign 0.00
R4033:Gm5346 UTSW 8 43626673 missense probably benign 0.28
R4072:Gm5346 UTSW 8 43626350 missense probably damaging 1.00
R4074:Gm5346 UTSW 8 43626350 missense probably damaging 1.00
R4075:Gm5346 UTSW 8 43626350 missense probably damaging 1.00
R4076:Gm5346 UTSW 8 43626350 missense probably damaging 1.00
R4153:Gm5346 UTSW 8 43626527 missense probably benign 0.04
R4330:Gm5346 UTSW 8 43626250 missense probably benign
R4612:Gm5346 UTSW 8 43626550 missense probably benign 0.09
R4662:Gm5346 UTSW 8 43627079 missense probably benign 0.26
R5032:Gm5346 UTSW 8 43626471 missense probably damaging 1.00
R5077:Gm5346 UTSW 8 43627163 missense possibly damaging 0.79
R5504:Gm5346 UTSW 8 43625282 missense probably damaging 1.00
R5697:Gm5346 UTSW 8 43626579 missense probably damaging 1.00
R6232:Gm5346 UTSW 8 43625912 missense probably benign 0.00
R6233:Gm5346 UTSW 8 43625912 missense probably benign 0.00
R6234:Gm5346 UTSW 8 43625912 missense probably benign 0.00
R6235:Gm5346 UTSW 8 43625912 missense probably benign 0.00
R6241:Gm5346 UTSW 8 43626096 missense probably benign 0.22
R6392:Gm5346 UTSW 8 43626001 missense probably benign 0.09
R6454:Gm5346 UTSW 8 43626808 missense probably damaging 0.96
R6455:Gm5346 UTSW 8 43626152 missense probably damaging 1.00
R6767:Gm5346 UTSW 8 43626914 missense probably damaging 1.00
R6774:Gm5346 UTSW 8 43625183 missense probably benign 0.00
R6877:Gm5346 UTSW 8 43625237 missense probably benign 0.02
R6911:Gm5346 UTSW 8 43625109 missense probably benign 0.02
R7211:Gm5346 UTSW 8 43625877 missense probably damaging 1.00
R7597:Gm5346 UTSW 8 43625244 missense probably damaging 1.00
R7602:Gm5346 UTSW 8 43626666 missense probably damaging 0.99
R7797:Gm5346 UTSW 8 43626374 missense probably benign 0.04
RF001:Gm5346 UTSW 8 43626905 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CACTCACCTGAAGTTCCATTGC -3'
(R):5'- ATGGAAGTGCATGTACATGTGG -3'

Sequencing Primer
(F):5'- ATTGCACCACTCTGGAAGGTC -3'
(R):5'- AAGTGCATGTACATGTGGGTTAC -3'
Posted On2018-05-24