Incidental Mutation 'R6439:Abhd6'
ID518944
Institutional Source Beutler Lab
Gene Symbol Abhd6
Ensembl Gene ENSMUSG00000025277
Gene Nameabhydrolase domain containing 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6439 (G1)
Quality Score219.009
Status Validated
Chromosome14
Chromosomal Location8002902-8056763 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8055589 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 272 (L272P)
Ref Sequence ENSEMBL: ENSMUSP00000153068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026313] [ENSMUST00000166497] [ENSMUST00000225234]
Predicted Effect probably damaging
Transcript: ENSMUST00000026313
AA Change: L319P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026313
Gene: ENSMUSG00000025277
AA Change: L319P

DomainStartEndE-ValueType
Pfam:Hydrolase_4 68 313 6.4e-17 PFAM
Pfam:Abhydrolase_1 72 193 3.8e-17 PFAM
Pfam:Abhydrolase_5 73 307 1e-17 PFAM
Pfam:Abhydrolase_6 74 319 9e-22 PFAM
Pfam:Abhydrolase_1 222 313 1.3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166497
AA Change: L319P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129169
Gene: ENSMUSG00000025277
AA Change: L319P

DomainStartEndE-ValueType
Pfam:Lipase 51 183 1.1e-8 PFAM
Pfam:Abhydrolase_5 73 307 8e-18 PFAM
Pfam:Abhydrolase_6 74 319 1.7e-39 PFAM
Pfam:Abhydrolase_1 98 322 3.9e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000225234
AA Change: L272P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik T C 15: 58,032,048 D18G probably null Het
A530064D06Rik A G 17: 48,166,485 V88A probably damaging Het
Adam25 C T 8: 40,754,590 R298C possibly damaging Het
Afap1l2 T C 19: 56,928,386 N219D possibly damaging Het
Brd3 A G 2: 27,463,926 F58S probably damaging Het
Ceacam3 G A 7: 17,158,328 R332H possibly damaging Het
Cfap57 C A 4: 118,588,975 probably null Het
Chd2 A G 7: 73,480,406 F834L probably damaging Het
Crocc2 A G 1: 93,183,404 K140E possibly damaging Het
Fam117b A G 1: 59,981,572 T534A probably benign Het
Fchsd1 C T 18: 37,969,434 V14I probably damaging Het
Gm5346 T C 8: 43,625,951 N412S probably damaging Het
Grid2ip A T 5: 143,373,502 E291V probably damaging Het
Hbp1 A G 12: 31,937,721 L146S probably damaging Het
Hr A G 14: 70,561,836 D616G possibly damaging Het
Igfbp5 A C 1: 72,863,141 probably null Het
Jak2 C T 19: 29,309,622 probably null Het
Mpl T C 4: 118,448,553 D425G probably damaging Het
Ms4a4c T C 19: 11,421,312 S165P probably benign Het
Mycbp2 A G 14: 103,155,475 S3217P probably benign Het
Nfatc3 T A 8: 106,083,870 L426* probably null Het
Olfr1317 T C 2: 112,142,164 V73A probably benign Het
Olfr8 T A 10: 78,955,984 Y260N probably damaging Het
Olfr994 T C 2: 85,430,724 Y35C probably damaging Het
Phf1 G T 17: 26,936,612 V384L probably benign Het
Rangap1 T C 15: 81,712,135 T259A probably benign Het
Rec8 A G 14: 55,618,619 N6S possibly damaging Het
Rmdn2 G A 17: 79,627,542 probably benign Het
Scin T C 12: 40,068,946 Y617C probably damaging Het
Ttc13 T C 8: 124,673,482 S744G probably benign Het
Ttc14 T C 3: 33,808,819 probably benign Het
Uggt1 T C 1: 36,174,951 E219G possibly damaging Het
Vmn1r183 A G 7: 24,055,279 D169G possibly damaging Het
Vmn1r72 A T 7: 11,679,137 probably null Het
Zfp326 T G 5: 105,888,718 M76R probably null Het
Other mutations in Abhd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02475:Abhd6 APN 14 8039849 missense probably damaging 0.96
R1757:Abhd6 UTSW 14 8049867 missense probably damaging 1.00
R2011:Abhd6 UTSW 14 8042742 missense probably benign 0.07
R2425:Abhd6 UTSW 14 8049857 missense probably benign 0.29
R3810:Abhd6 UTSW 14 8045603 missense probably benign 0.01
R4809:Abhd6 UTSW 14 8039771 start codon destroyed probably null 1.00
R5841:Abhd6 UTSW 14 8049596 missense probably benign 0.02
R5878:Abhd6 UTSW 14 8028286 missense probably benign 0.13
R6582:Abhd6 UTSW 14 8042826 missense probably damaging 1.00
R6582:Abhd6 UTSW 14 8042828 critical splice donor site probably null
R6924:Abhd6 UTSW 14 8049850 missense possibly damaging 0.71
R7684:Abhd6 UTSW 14 8039807 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGGAAGTCACACTGTAC -3'
(R):5'- GCTCTGTGGAACCAAGGATAC -3'

Sequencing Primer
(F):5'- GGCAGACATATTAGCCAAG -3'
(R):5'- AACTGGCTTCCTCAGGGCTG -3'
Posted On2018-05-24