Mutagenetix > Incidental Mutation

Incidental Mutation 'R6440:Ncbp1'

518963

Institutional Source

Beutler Lab

Gene Symbol

Ncbp1

Ensembl Gene

ENSMUSG00000028330

Gene Name

nuclear cap binding protein subunit 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6440 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

46138613-46172403 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 46147516 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 121 (Y121C)

Ref Sequence

ENSEMBL: ENSMUSP00000030014 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030014]

AlphaFold

Q3UYV9

PDB Structure

Mouse importin alpha: mouse CBP80 cNLS complex [X-RAY DIFFRACTION]
Mouse importin alpha: mouse CBP80Y8D cNLS complex [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000030014
AA Change: Y121C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000030014
Gene: ENSMUSG00000028330
AA Change: Y121C

Domain	Start	End	E-Value	Type
MIF4G	28	240	1.33e-38	SMART
Pfam:MIF4G_like	309	471	1.4e-37	PFAM
Pfam:MIF4G_like_2	485	754	4e-78	PFAM

Meta Mutation Damage Score

0.4705

Coding Region Coverage

1x: 100.0%
3x: 99.7%
10x: 98.1%
20x: 93.7%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the nuclear cap-binding protein complex (CBC), which binds to the monomethylated 5' cap of nascent pre-mRNA in the nucleoplasm. The encoded protein promotes high-affinity mRNA-cap binding and associates with the CTD of RNA polymerase II. The CBC promotes pre-mRNA splicing, 3'-end processing, RNA nuclear export, and nonsense-mediated mRNA decay. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgre4	T	C	17: 55,794,744		probably null	Het
Adgrl3	C	T	5: 81,794,494	Q684*	probably null	Het
Ahi1	T	A	10: 20,960,082		probably benign	Het
Aox1	A	G	1: 58,094,472	T1070A	probably damaging	Het
B3gnt9	C	T	8: 105,253,899		probably null	Het
C3ar1	G	T	6: 122,850,508	A250E	probably damaging	Het
Caprin2	A	G	6: 148,869,645	F284L	probably damaging	Het
Cdc25a	T	C	9: 109,881,498	I90T	probably benign	Het
Cdh9	A	T	15: 16,823,423	T164S	probably benign	Het
Ces2a	C	T	8: 104,741,322	A528V	probably benign	Het
Cyp2c70	T	C	19: 40,156,806	N402S	possibly damaging	Het
F3	A	G	3: 121,725,037	E50G	probably damaging	Het
Fli1	A	T	9: 32,423,901	S412T	probably benign	Het
Flt1	T	A	5: 147,564,305	D1306V	possibly damaging	Het
Ggt7	T	C	2: 155,498,811	D424G	probably damaging	Het
Gm5615	T	A	9: 36,541,872	M1L	probably benign	Het
Grm7	A	T	6: 111,254,020	N468I	probably damaging	Het
Htr5a	T	A	5: 27,850,872	V287E	probably damaging	Het
Map3k21	T	C	8: 125,911,137	V154A	probably damaging	Het
Muc16	A	G	9: 18,641,359	V4546A	probably benign	Het
Nckap1l	C	A	15: 103,471,232	Y315*	probably null	Het
Ntpcr	T	A	8: 125,745,242	S64T	probably damaging	Het
Olfr376	A	T	11: 73,375,347	E202D	probably benign	Het
Olfr811	A	G	10: 129,801,968	S186P	probably damaging	Het
Olfr869	T	C	9: 20,137,194	F26S	probably damaging	Het
Pde4dip	A	G	3: 97,767,586	C5R	probably damaging	Het
Pgap2	T	A	7: 102,237,387		probably null	Het
Pik3r6	T	C	11: 68,533,696	W376R	probably benign	Het
Plekha2	T	C	8: 25,088,397	Y29C	probably damaging	Het
Pms1	T	C	1: 53,195,021	K779E	probably damaging	Het
Prss16	A	G	13: 22,003,160	V98A	probably damaging	Het
Robo2	C	T	16: 73,916,122	D1287N	probably benign	Het
Sgsm1	A	G	5: 113,279,131		probably null	Het
Slc40a1	A	T	1: 45,925,262	M1K	probably null	Het
Smo	A	G	6: 29,756,814	H437R	possibly damaging	Het
Sult3a1	T	C	10: 33,870,202	Y173H	possibly damaging	Het
Svep1	T	A	4: 58,116,555	R898S	possibly damaging	Het
Synpo2l	A	G	14: 20,668,176	V7A	probably damaging	Het
Thsd1	C	T	8: 22,258,553	A427V	possibly damaging	Het
Tnfrsf17	G	A	16: 11,319,890	G164S	probably benign	Het
Zfp235	A	G	7: 24,140,615	K153R	probably damaging	Het

Other mutations in Ncbp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00840:Ncbp1	APN	4	46161307	missense	probably damaging	1.00
IGL02085:Ncbp1	APN	4	46159699	missense	probably damaging	0.96
IGL02230:Ncbp1	APN	4	46165272	missense	probably benign	0.03
IGL02561:Ncbp1	APN	4	46159711	missense	possibly damaging	0.80
IGL02574:Ncbp1	APN	4	46168449	critical splice acceptor site	probably null
IGL03371:Ncbp1	APN	4	46171991	nonsense	probably null
R0549:Ncbp1	UTSW	4	46168476	missense	possibly damaging	0.69
R0594:Ncbp1	UTSW	4	46170551	missense	probably benign	0.00
R0699:Ncbp1	UTSW	4	46147528	missense	probably benign	0.17
R0725:Ncbp1	UTSW	4	46152056	missense	probably benign	0.01
R0961:Ncbp1	UTSW	4	46165193	missense	possibly damaging	0.69
R1330:Ncbp1	UTSW	4	46167354	missense	probably benign	0.19
R1622:Ncbp1	UTSW	4	46171963	missense	possibly damaging	0.60
R1756:Ncbp1	UTSW	4	46169131	nonsense	probably null
R2417:Ncbp1	UTSW	4	46168530	missense	probably benign	0.20
R4050:Ncbp1	UTSW	4	46147483	missense	probably damaging	0.99
R4132:Ncbp1	UTSW	4	46169241	nonsense	probably null
R4516:Ncbp1	UTSW	4	46157824	missense	probably damaging	1.00
R4795:Ncbp1	UTSW	4	46152967	missense	possibly damaging	0.83
R4796:Ncbp1	UTSW	4	46152967	missense	possibly damaging	0.83
R4960:Ncbp1	UTSW	4	46165273	nonsense	probably null
R5557:Ncbp1	UTSW	4	46165259	missense	probably benign	0.01
R5626:Ncbp1	UTSW	4	46161290	missense	probably damaging	1.00
R5682:Ncbp1	UTSW	4	46170474	unclassified	probably benign
R5859:Ncbp1	UTSW	4	46163026	missense	probably benign	0.00
R6377:Ncbp1	UTSW	4	46150703	missense	probably damaging	1.00
R6793:Ncbp1	UTSW	4	46157827	missense	probably damaging	0.99
R7078:Ncbp1	UTSW	4	46155756	missense	probably benign	0.00
R7434:Ncbp1	UTSW	4	46149910	missense	probably damaging	1.00
R7445:Ncbp1	UTSW	4	46149914	missense	probably damaging	0.98
R7477:Ncbp1	UTSW	4	46157897	missense	probably damaging	1.00
R7670:Ncbp1	UTSW	4	46170015	missense	probably damaging	0.96
R8424:Ncbp1	UTSW	4	46144839	missense	probably benign
R8970:Ncbp1	UTSW	4	46170023	missense	probably damaging	0.99
R9712:Ncbp1	UTSW	4	46144837	missense	probably benign	0.03
X0013:Ncbp1	UTSW	4	46150702	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TGTATCTGCACACTGCCCAG -3'
(R):5'- TAGCCCGGAATGAGCTTACAGG -3'

Sequencing Primer
(F):5'- ACTGCCCAGTGATGCTGTGTC -3'
(R):5'- CTTACAGGAGAGGGGTGTAAATAGC -3'

Posted On

2018-05-24