Mutagenetix > Incidental Mutation

Incidental Mutation 'R6440:Flt1'

518968

Institutional Source

Beutler Lab

Gene Symbol

Flt1

Ensembl Gene

ENSMUSG00000029648

Gene Name

FMS-like tyrosine kinase 1

Synonyms

Flt-1, VEGFR1, vascular endothelial growth factor receptor-1, sFlt1, VEGFR-1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6440 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

147561604-147726011 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 147564305 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 1306 (D1306V)

Ref Sequence

ENSEMBL: ENSMUSP00000031653 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031653]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031653
AA Change: D1306V

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000031653
Gene: ENSMUSG00000029648
AA Change: D1306V

Domain	Start	End	E-Value	Type
IG	38	130	1.74e-3	SMART
IG	144	225	1.49e-2	SMART
IG	238	330	2.23e-10	SMART
IG	345	426	2.43e-2	SMART
IG	440	554	2.6e-2	SMART
IGc2	569	644	1.76e-8	SMART
IGc2	674	739	6.29e-19	SMART
low complexity region	769	786	N/A	INTRINSIC
TyrKc	828	1154	9.54e-144	SMART

Meta Mutation Damage Score

0.0919

Coding Region Coverage

1x: 100.0%
3x: 99.7%
10x: 98.1%
20x: 93.7%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vascular endothelial growth factor receptor (VEGFR) family. VEGFR family members are receptor tyrosine kinases (RTKs) which contain an extracellular ligand-binding region with seven immunoglobulin (Ig)-like domains, a transmembrane segment, and a tyrosine kinase (TK) domain within the cytoplasmic domain. This protein binds to VEGFR-A, VEGFR-B and placental growth factor and plays an important role in angiogenesis and vasculogenesis. Expression of this receptor is found in vascular endothelial cells, placental trophoblast cells and peripheral blood monocytes. Multiple transcript variants encoding different isoforms have been found for this gene. Isoforms include a full-length transmembrane receptor isoform and shortened, soluble isoforms. The soluble isoforms are associated with the onset of pre-eclampsia.[provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit an excess of hemangioblasts resulting in an overgrowth of endothelial cells, abnormalities of vascular channels and blood islands, and lethality at the mid-somite developmental stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgre4	T	C	17: 55,794,744		probably null	Het
Adgrl3	C	T	5: 81,794,494	Q684*	probably null	Het
Ahi1	T	A	10: 20,960,082		probably benign	Het
Aox1	A	G	1: 58,094,472	T1070A	probably damaging	Het
B3gnt9	C	T	8: 105,253,899		probably null	Het
C3ar1	G	T	6: 122,850,508	A250E	probably damaging	Het
Caprin2	A	G	6: 148,869,645	F284L	probably damaging	Het
Cdc25a	T	C	9: 109,881,498	I90T	probably benign	Het
Cdh9	A	T	15: 16,823,423	T164S	probably benign	Het
Ces2a	C	T	8: 104,741,322	A528V	probably benign	Het
Cyp2c70	T	C	19: 40,156,806	N402S	possibly damaging	Het
F3	A	G	3: 121,725,037	E50G	probably damaging	Het
Fli1	A	T	9: 32,423,901	S412T	probably benign	Het
Ggt7	T	C	2: 155,498,811	D424G	probably damaging	Het
Gm5615	T	A	9: 36,541,872	M1L	probably benign	Het
Grm7	A	T	6: 111,254,020	N468I	probably damaging	Het
Htr5a	T	A	5: 27,850,872	V287E	probably damaging	Het
Map3k21	T	C	8: 125,911,137	V154A	probably damaging	Het
Muc16	A	G	9: 18,641,359	V4546A	probably benign	Het
Ncbp1	A	G	4: 46,147,516	Y121C	probably damaging	Het
Nckap1l	C	A	15: 103,471,232	Y315*	probably null	Het
Ntpcr	T	A	8: 125,745,242	S64T	probably damaging	Het
Olfr376	A	T	11: 73,375,347	E202D	probably benign	Het
Olfr811	A	G	10: 129,801,968	S186P	probably damaging	Het
Olfr869	T	C	9: 20,137,194	F26S	probably damaging	Het
Pde4dip	A	G	3: 97,767,586	C5R	probably damaging	Het
Pgap2	T	A	7: 102,237,387		probably null	Het
Pik3r6	T	C	11: 68,533,696	W376R	probably benign	Het
Plekha2	T	C	8: 25,088,397	Y29C	probably damaging	Het
Pms1	T	C	1: 53,195,021	K779E	probably damaging	Het
Prss16	A	G	13: 22,003,160	V98A	probably damaging	Het
Robo2	C	T	16: 73,916,122	D1287N	probably benign	Het
Sgsm1	A	G	5: 113,279,131		probably null	Het
Slc40a1	A	T	1: 45,925,262	M1K	probably null	Het
Smo	A	G	6: 29,756,814	H437R	possibly damaging	Het
Sult3a1	T	C	10: 33,870,202	Y173H	possibly damaging	Het
Svep1	T	A	4: 58,116,555	R898S	possibly damaging	Het
Synpo2l	A	G	14: 20,668,176	V7A	probably damaging	Het
Thsd1	C	T	8: 22,258,553	A427V	possibly damaging	Het
Tnfrsf17	G	A	16: 11,319,890	G164S	probably benign	Het
Zfp235	A	G	7: 24,140,615	K153R	probably damaging	Het

Other mutations in Flt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Flt1	APN	5	147580300	critical splice donor site	probably null
IGL00469:Flt1	APN	5	147603605	missense	probably damaging	0.99
IGL00897:Flt1	APN	5	147589854	missense	probably benign	0.25
IGL01111:Flt1	APN	5	147578336	missense	probably damaging	1.00
IGL01154:Flt1	APN	5	147576156	missense	possibly damaging	0.63
IGL01744:Flt1	APN	5	147571461	missense	probably benign	0.01
IGL01973:Flt1	APN	5	147683889	missense	probably benign	0.01
IGL02079:Flt1	APN	5	147568831	splice site	probably benign
IGL02143:Flt1	APN	5	147578436	missense	probably benign	0.00
IGL02156:Flt1	APN	5	147681741	missense	probably damaging	0.99
IGL02345:Flt1	APN	5	147582626	missense	probably benign	0.20
IGL02548:Flt1	APN	5	147639248	missense	probably benign	0.00
IGL02631:Flt1	APN	5	147673574	nonsense	probably null
IGL02686:Flt1	APN	5	147588602	missense	probably damaging	1.00
IGL02938:Flt1	APN	5	147678299	missense	possibly damaging	0.47
IGL03057:Flt1	APN	5	147681924	nonsense	probably null
IGL03196:Flt1	APN	5	147615127	critical splice donor site	probably null
IGL03205:Flt1	APN	5	147699821	missense	probably benign	0.00
IGL03255:Flt1	APN	5	147588521	splice site	probably benign
flywheels	UTSW	5	147599646	missense	probably damaging	1.00
BB008:Flt1	UTSW	5	147588572	missense	probably damaging	1.00
BB018:Flt1	UTSW	5	147588572	missense	probably damaging	1.00
IGL02837:Flt1	UTSW	5	147655170	missense	probably benign	0.32
PIT4402001:Flt1	UTSW	5	147678239	missense	probably damaging	1.00
R0013:Flt1	UTSW	5	147571014	splice site	probably benign
R0380:Flt1	UTSW	5	147588572	missense	probably damaging	1.00
R0448:Flt1	UTSW	5	147566394	splice site	probably benign
R0789:Flt1	UTSW	5	147639483	missense	probably damaging	1.00
R1005:Flt1	UTSW	5	147681885	missense	probably damaging	0.99
R1241:Flt1	UTSW	5	147599646	missense	probably damaging	1.00
R1302:Flt1	UTSW	5	147564240	missense	possibly damaging	0.93
R1411:Flt1	UTSW	5	147580316	missense	probably damaging	1.00
R1615:Flt1	UTSW	5	147639288	missense	probably damaging	1.00
R1634:Flt1	UTSW	5	147676430	missense	probably damaging	1.00
R1749:Flt1	UTSW	5	147655119	missense	probably benign	0.00
R1768:Flt1	UTSW	5	147672709	missense	probably damaging	1.00
R1972:Flt1	UTSW	5	147655093	splice site	probably benign
R2074:Flt1	UTSW	5	147599606	missense	possibly damaging	0.82
R2081:Flt1	UTSW	5	147639422	missense	probably damaging	1.00
R2864:Flt1	UTSW	5	147594621	missense	possibly damaging	0.68
R2865:Flt1	UTSW	5	147594621	missense	possibly damaging	0.68
R3740:Flt1	UTSW	5	147599593	missense	probably damaging	1.00
R3820:Flt1	UTSW	5	147700017	splice site	probably benign
R4089:Flt1	UTSW	5	147564241	missense	probably benign	0.03
R4299:Flt1	UTSW	5	147683907	missense	probably benign	0.00
R4570:Flt1	UTSW	5	147594613	missense	probably damaging	1.00
R4812:Flt1	UTSW	5	147683939	missense	probably benign	0.30
R4853:Flt1	UTSW	5	147683939	missense	probably benign	0.30
R4865:Flt1	UTSW	5	147683939	missense	probably benign	0.30
R4900:Flt1	UTSW	5	147683939	missense	probably benign	0.30
R4906:Flt1	UTSW	5	147683939	missense	probably benign	0.30
R4907:Flt1	UTSW	5	147683939	missense	probably benign	0.30
R4909:Flt1	UTSW	5	147683939	missense	probably benign	0.30
R5072:Flt1	UTSW	5	147683939	missense	probably benign	0.30
R5073:Flt1	UTSW	5	147683939	missense	probably benign	0.30
R5074:Flt1	UTSW	5	147683939	missense	probably benign	0.30
R5218:Flt1	UTSW	5	147681928	missense	probably damaging	1.00
R5547:Flt1	UTSW	5	147655138	missense	probably damaging	1.00
R5731:Flt1	UTSW	5	147678152	missense	probably benign	0.16
R5732:Flt1	UTSW	5	147634483	nonsense	probably null
R5804:Flt1	UTSW	5	147580437	splice site	probably null
R6107:Flt1	UTSW	5	147603593	missense	probably benign	0.15
R6453:Flt1	UTSW	5	147683941	missense	possibly damaging	0.80
R6539:Flt1	UTSW	5	147578376	missense	probably benign	0.27
R7068:Flt1	UTSW	5	147673634	missense	probably damaging	1.00
R7112:Flt1	UTSW	5	147603569	missense	probably damaging	1.00
R7195:Flt1	UTSW	5	147603576	missense	probably damaging	1.00
R7255:Flt1	UTSW	5	147580406	missense	probably damaging	1.00
R7347:Flt1	UTSW	5	147580381	missense	probably damaging	1.00
R7469:Flt1	UTSW	5	147603569	missense	probably damaging	1.00
R7473:Flt1	UTSW	5	147594595	missense	probably damaging	1.00
R7663:Flt1	UTSW	5	147655120	missense	probably benign
R7688:Flt1	UTSW	5	147676325	missense	probably benign
R7729:Flt1	UTSW	5	147700367	missense	probably benign	0.00
R7931:Flt1	UTSW	5	147588572	missense	probably damaging	1.00
R8051:Flt1	UTSW	5	147582691	missense	probably benign	0.02
R8275:Flt1	UTSW	5	147678147	missense	probably damaging	0.99
R8434:Flt1	UTSW	5	147639443	missense	probably damaging	0.97
R8442:Flt1	UTSW	5	147576173	missense	probably damaging	1.00
R8756:Flt1	UTSW	5	147639414	missense	probably benign	0.07
R8855:Flt1	UTSW	5	147570872	missense	probably benign	0.00
R8855:Flt1	UTSW	5	147681650	missense	probably damaging	1.00
R9165:Flt1	UTSW	5	147615237	missense	probably damaging	0.99
R9240:Flt1	UTSW	5	147681866	missense	probably benign
R9439:Flt1	UTSW	5	147578397	missense	probably damaging	1.00
R9658:Flt1	UTSW	5	147588567	missense	probably damaging	0.97
X0064:Flt1	UTSW	5	147673613	missense	probably damaging	1.00
Z1088:Flt1	UTSW	5	147681649	missense	possibly damaging	0.79

Predicted Primers

PCR Primer
(F):5'- ACACGTCACTAACTGGGGTTAC -3'
(R):5'- TAGGCAGTCATTAGTCTTTGCC -3'

Sequencing Primer
(F):5'- CACTAACTGGGGTTACATTCTTG -3'
(R):5'- TAGTCTTTGCCCAGAAAACATCAGG -3'

Posted On

2018-05-24