Incidental Mutation 'R6440:C3ar1'
ID 518971
Institutional Source Beutler Lab
Gene Symbol C3ar1
Ensembl Gene ENSMUSG00000040552
Gene Name complement component 3a receptor 1
Synonyms C3aR, anaphylatoxin C3a receptor
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6440 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 122847138-122856161 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 122850508 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 250 (A250E)
Ref Sequence ENSEMBL: ENSMUSP00000048092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042081]
AlphaFold O09047
Predicted Effect probably damaging
Transcript: ENSMUST00000042081
AA Change: A250E

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048092
Gene: ENSMUSG00000040552
AA Change: A250E

DomainStartEndE-ValueType
Pfam:7tm_1 40 193 8.1e-25 PFAM
Pfam:7TM_GPCR_Srsx 281 443 7.8e-8 PFAM
Pfam:7tm_1 313 428 6.5e-17 PFAM
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.7%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] C3a is an anaphylatoxin released during activation of the complement system. The protein encoded by this gene is an orphan G protein-coupled receptor for C3a. Binding of C3a by the encoded receptor activates chemotaxis, granule enzyme release, superoxide anion production, and bacterial opsonization. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous targeted mutants display protective effects against the changes in lung physiology after allergen challenge, increased lethality to endotoxin shock, and elevated IL1B following LPS challenge, supporting the role of C3arin proinflammatory responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 T C 17: 55,794,744 probably null Het
Adgrl3 C T 5: 81,794,494 Q684* probably null Het
Ahi1 T A 10: 20,960,082 probably benign Het
Aox1 A G 1: 58,094,472 T1070A probably damaging Het
B3gnt9 C T 8: 105,253,899 probably null Het
Caprin2 A G 6: 148,869,645 F284L probably damaging Het
Cdc25a T C 9: 109,881,498 I90T probably benign Het
Cdh9 A T 15: 16,823,423 T164S probably benign Het
Ces2a C T 8: 104,741,322 A528V probably benign Het
Cyp2c70 T C 19: 40,156,806 N402S possibly damaging Het
F3 A G 3: 121,725,037 E50G probably damaging Het
Fli1 A T 9: 32,423,901 S412T probably benign Het
Flt1 T A 5: 147,564,305 D1306V possibly damaging Het
Ggt7 T C 2: 155,498,811 D424G probably damaging Het
Gm5615 T A 9: 36,541,872 M1L probably benign Het
Grm7 A T 6: 111,254,020 N468I probably damaging Het
Htr5a T A 5: 27,850,872 V287E probably damaging Het
Map3k21 T C 8: 125,911,137 V154A probably damaging Het
Muc16 A G 9: 18,641,359 V4546A probably benign Het
Ncbp1 A G 4: 46,147,516 Y121C probably damaging Het
Nckap1l C A 15: 103,471,232 Y315* probably null Het
Ntpcr T A 8: 125,745,242 S64T probably damaging Het
Olfr376 A T 11: 73,375,347 E202D probably benign Het
Olfr811 A G 10: 129,801,968 S186P probably damaging Het
Olfr869 T C 9: 20,137,194 F26S probably damaging Het
Pde4dip A G 3: 97,767,586 C5R probably damaging Het
Pgap2 T A 7: 102,237,387 probably null Het
Pik3r6 T C 11: 68,533,696 W376R probably benign Het
Plekha2 T C 8: 25,088,397 Y29C probably damaging Het
Pms1 T C 1: 53,195,021 K779E probably damaging Het
Prss16 A G 13: 22,003,160 V98A probably damaging Het
Robo2 C T 16: 73,916,122 D1287N probably benign Het
Sgsm1 A G 5: 113,279,131 probably null Het
Slc40a1 A T 1: 45,925,262 M1K probably null Het
Smo A G 6: 29,756,814 H437R possibly damaging Het
Sult3a1 T C 10: 33,870,202 Y173H possibly damaging Het
Svep1 T A 4: 58,116,555 R898S possibly damaging Het
Synpo2l A G 14: 20,668,176 V7A probably damaging Het
Thsd1 C T 8: 22,258,553 A427V possibly damaging Het
Tnfrsf17 G A 16: 11,319,890 G164S probably benign Het
Zfp235 A G 7: 24,140,615 K153R probably damaging Het
Other mutations in C3ar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01818:C3ar1 APN 6 122850419 missense probably benign 0.00
IGL01936:C3ar1 APN 6 122851235 missense probably benign 0.04
IGL01998:C3ar1 APN 6 122850940 missense probably damaging 1.00
IGL02351:C3ar1 APN 6 122849975 missense probably damaging 1.00
IGL02358:C3ar1 APN 6 122849975 missense probably damaging 1.00
IGL02399:C3ar1 APN 6 122849879 missense probably benign 0.00
PIT4618001:C3ar1 UTSW 6 122850787 missense probably benign 0.25
R0014:C3ar1 UTSW 6 122850851 missense probably damaging 1.00
R0195:C3ar1 UTSW 6 122851155 missense possibly damaging 0.95
R0257:C3ar1 UTSW 6 122850787 missense probably benign 0.25
R0344:C3ar1 UTSW 6 122850772 missense probably benign 0.45
R4345:C3ar1 UTSW 6 122850700 missense probably damaging 1.00
R4614:C3ar1 UTSW 6 122850721 missense probably benign 0.00
R4643:C3ar1 UTSW 6 122850974 missense probably damaging 1.00
R4840:C3ar1 UTSW 6 122850764 missense probably benign
R5235:C3ar1 UTSW 6 122850922 missense probably damaging 1.00
R5303:C3ar1 UTSW 6 122849835 missense probably damaging 1.00
R5610:C3ar1 UTSW 6 122850578 missense probably benign 0.01
R5762:C3ar1 UTSW 6 122850362 missense probably benign 0.07
R5873:C3ar1 UTSW 6 122850422 missense probably benign 0.24
R5877:C3ar1 UTSW 6 122850622 missense probably benign 0.17
R6327:C3ar1 UTSW 6 122850146 missense probably damaging 1.00
R6505:C3ar1 UTSW 6 122850640 missense probably benign 0.03
R6636:C3ar1 UTSW 6 122851054 missense probably damaging 1.00
R6755:C3ar1 UTSW 6 122849858 missense probably benign 0.00
R6953:C3ar1 UTSW 6 122850632 missense possibly damaging 0.49
R7985:C3ar1 UTSW 6 122850005 missense probably damaging 1.00
R8049:C3ar1 UTSW 6 122850100 missense probably damaging 0.97
R8936:C3ar1 UTSW 6 122851085 missense probably damaging 0.97
R9337:C3ar1 UTSW 6 122850319 missense probably benign 0.00
X0065:C3ar1 UTSW 6 122850765 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACGTGAATTGGTCAACATAATCCC -3'
(R):5'- TGGGACTACGTGTACAAACTAAG -3'

Sequencing Primer
(F):5'- TCCCCCTGGAAATCATAGGG -3'
(R):5'- GGACTACGTGTACAAACTAAGTCTAC -3'
Posted On 2018-05-24