Incidental Mutation 'R6440:Zfp235'
ID518973
Institutional Source Beutler Lab
Gene Symbol Zfp235
Ensembl Gene ENSMUSG00000047603
Gene Namezinc finger protein 235
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6440 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location24134169-24143241 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24140615 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 153 (K153R)
Ref Sequence ENSEMBL: ENSMUSP00000050803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056549] [ENSMUST00000205680]
Predicted Effect probably damaging
Transcript: ENSMUST00000056549
AA Change: K153R

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000050803
Gene: ENSMUSG00000047603
AA Change: K153R

DomainStartEndE-ValueType
KRAB 8 71 1.09e-15 SMART
ZnF_C2H2 283 305 1.79e-2 SMART
ZnF_C2H2 311 333 3.16e-3 SMART
ZnF_C2H2 339 361 1.18e-2 SMART
ZnF_C2H2 367 389 6.99e-5 SMART
ZnF_C2H2 395 417 1.33e-1 SMART
ZnF_C2H2 423 445 3.16e-3 SMART
ZnF_C2H2 451 473 2.84e-5 SMART
ZnF_C2H2 479 501 6.32e-3 SMART
ZnF_C2H2 507 529 3.44e-4 SMART
ZnF_C2H2 535 557 2.12e-4 SMART
ZnF_C2H2 563 585 1.38e-3 SMART
ZnF_C2H2 591 613 2.27e-4 SMART
ZnF_C2H2 619 641 5.99e-4 SMART
ZnF_C2H2 647 669 5.9e-3 SMART
ZnF_C2H2 675 697 4.87e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000205680
AA Change: K223R

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206809
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.7%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the zinc finger protein superfamily, members of which are regulatory proteins characterized by nucleic acid-binding zinc finger domains. The encoded protein is a member of the Kruppel family of zinc finger proteins, and contains Kruppel-associated box (KRAB) A and B domains and 15 tandemly arrayed C2H2-type zinc fingers. It is an ortholog of the mouse Zfp93 protein. This gene is located in a cluster of zinc finger genes on 19q13.2. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 T C 17: 55,794,744 probably null Het
Adgrl3 C T 5: 81,794,494 Q684* probably null Het
Ahi1 T A 10: 20,960,082 probably benign Het
Aox1 A G 1: 58,094,472 T1070A probably damaging Het
B3gnt9 C T 8: 105,253,899 probably null Het
C3ar1 G T 6: 122,850,508 A250E probably damaging Het
Caprin2 A G 6: 148,869,645 F284L probably damaging Het
Cdc25a T C 9: 109,881,498 I90T probably benign Het
Cdh9 A T 15: 16,823,423 T164S probably benign Het
Ces2a C T 8: 104,741,322 A528V probably benign Het
Cyp2c70 T C 19: 40,156,806 N402S possibly damaging Het
F3 A G 3: 121,725,037 E50G probably damaging Het
Fli1 A T 9: 32,423,901 S412T probably benign Het
Flt1 T A 5: 147,564,305 D1306V possibly damaging Het
Ggt7 T C 2: 155,498,811 D424G probably damaging Het
Gm5615 T A 9: 36,541,872 M1L probably benign Het
Grm7 A T 6: 111,254,020 N468I probably damaging Het
Htr5a T A 5: 27,850,872 V287E probably damaging Het
Map3k21 T C 8: 125,911,137 V154A probably damaging Het
Muc16 A G 9: 18,641,359 V4546A probably benign Het
Ncbp1 A G 4: 46,147,516 Y121C probably damaging Het
Nckap1l C A 15: 103,471,232 Y315* probably null Het
Ntpcr T A 8: 125,745,242 S64T probably damaging Het
Olfr376 A T 11: 73,375,347 E202D probably benign Het
Olfr811 A G 10: 129,801,968 S186P probably damaging Het
Olfr869 T C 9: 20,137,194 F26S probably damaging Het
Pde4dip A G 3: 97,767,586 C5R probably damaging Het
Pgap2 T A 7: 102,237,387 probably null Het
Pik3r6 T C 11: 68,533,696 W376R probably benign Het
Plekha2 T C 8: 25,088,397 Y29C probably damaging Het
Pms1 T C 1: 53,195,021 K779E probably damaging Het
Prss16 A G 13: 22,003,160 V98A probably damaging Het
Robo2 C T 16: 73,916,122 D1287N probably benign Het
Sgsm1 A G 5: 113,279,131 probably null Het
Slc40a1 A T 1: 45,925,262 M1K probably null Het
Smo A G 6: 29,756,814 H437R possibly damaging Het
Sult3a1 T C 10: 33,870,202 Y173H possibly damaging Het
Svep1 T A 4: 58,116,555 R898S possibly damaging Het
Synpo2l A G 14: 20,668,176 V7A probably damaging Het
Thsd1 C T 8: 22,258,553 A427V possibly damaging Het
Tnfrsf17 G A 16: 11,319,890 G164S probably benign Het
Other mutations in Zfp235
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Zfp235 APN 7 24137080 missense probably damaging 1.00
IGL02326:Zfp235 APN 7 24135302 start codon destroyed probably null 0.98
R0107:Zfp235 UTSW 7 24137116 missense probably damaging 1.00
R0271:Zfp235 UTSW 7 24137131 missense possibly damaging 0.93
R0513:Zfp235 UTSW 7 24142219 missense probably damaging 1.00
R1004:Zfp235 UTSW 7 24140744 missense probably damaging 1.00
R1928:Zfp235 UTSW 7 24141138 nonsense probably null
R1958:Zfp235 UTSW 7 24140346 missense probably damaging 0.98
R2167:Zfp235 UTSW 7 24140962 missense possibly damaging 0.80
R2511:Zfp235 UTSW 7 24142124 missense probably damaging 1.00
R3013:Zfp235 UTSW 7 24140732 missense probably damaging 0.98
R3806:Zfp235 UTSW 7 24140621 missense probably benign 0.01
R4613:Zfp235 UTSW 7 24141676 missense probably damaging 1.00
R4876:Zfp235 UTSW 7 24140959 missense probably benign 0.01
R4977:Zfp235 UTSW 7 24142184 missense possibly damaging 0.94
R5085:Zfp235 UTSW 7 24137121 missense probably damaging 0.96
R5664:Zfp235 UTSW 7 24142151 missense probably damaging 1.00
R6650:Zfp235 UTSW 7 24137038 splice site probably null
R7694:Zfp235 UTSW 7 24142100 missense probably benign 0.37
R8031:Zfp235 UTSW 7 24141689 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- ATGTCAAGAAACTGGCCAGC -3'
(R):5'- GAAGATGACTTGATCACAGTCACC -3'

Sequencing Primer
(F):5'- CCAGCACTCCAGATGTTGTAG -3'
(R):5'- TCACCACTGCTGGGGACTTTG -3'
Posted On2018-05-24