Incidental Mutation 'R6440:Ces2a'
ID518977
Institutional Source Beutler Lab
Gene Symbol Ces2a
Ensembl Gene ENSMUSG00000055730
Gene Namecarboxylesterase 2A
SynonymsCes6, 9130231C15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6440 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location104734003-104741634 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104741322 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 528 (A528V)
Ref Sequence ENSEMBL: ENSMUSP00000034346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034346] [ENSMUST00000161824] [ENSMUST00000164182]
Predicted Effect probably benign
Transcript: ENSMUST00000034346
AA Change: A528V

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000034346
Gene: ENSMUSG00000055730
AA Change: A528V

DomainStartEndE-ValueType
Pfam:COesterase 9 537 1.2e-171 PFAM
Pfam:Abhydrolase_3 142 267 2.9e-11 PFAM
Pfam:Peptidase_S9 156 347 7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159303
Predicted Effect probably benign
Transcript: ENSMUST00000161824
Predicted Effect probably benign
Transcript: ENSMUST00000164182
AA Change: A495V

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000127346
Gene: ENSMUSG00000055730
AA Change: A495V

DomainStartEndE-ValueType
Pfam:COesterase 8 276 5e-110 PFAM
Pfam:Abhydrolase_3 142 267 2.6e-11 PFAM
Pfam:Peptidase_S9 156 275 3e-7 PFAM
Pfam:COesterase 259 504 8.3e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.7%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 T C 17: 55,794,744 probably null Het
Adgrl3 C T 5: 81,794,494 Q684* probably null Het
Ahi1 T A 10: 20,960,082 probably benign Het
Aox1 A G 1: 58,094,472 T1070A probably damaging Het
B3gnt9 C T 8: 105,253,899 probably null Het
C3ar1 G T 6: 122,850,508 A250E probably damaging Het
Caprin2 A G 6: 148,869,645 F284L probably damaging Het
Cdc25a T C 9: 109,881,498 I90T probably benign Het
Cdh9 A T 15: 16,823,423 T164S probably benign Het
Cyp2c70 T C 19: 40,156,806 N402S possibly damaging Het
F3 A G 3: 121,725,037 E50G probably damaging Het
Fli1 A T 9: 32,423,901 S412T probably benign Het
Flt1 T A 5: 147,564,305 D1306V possibly damaging Het
Ggt7 T C 2: 155,498,811 D424G probably damaging Het
Gm5615 T A 9: 36,541,872 M1L probably benign Het
Grm7 A T 6: 111,254,020 N468I probably damaging Het
Htr5a T A 5: 27,850,872 V287E probably damaging Het
Map3k21 T C 8: 125,911,137 V154A probably damaging Het
Muc16 A G 9: 18,641,359 V4546A probably benign Het
Ncbp1 A G 4: 46,147,516 Y121C probably damaging Het
Nckap1l C A 15: 103,471,232 Y315* probably null Het
Ntpcr T A 8: 125,745,242 S64T probably damaging Het
Olfr376 A T 11: 73,375,347 E202D probably benign Het
Olfr811 A G 10: 129,801,968 S186P probably damaging Het
Olfr869 T C 9: 20,137,194 F26S probably damaging Het
Pde4dip A G 3: 97,767,586 C5R probably damaging Het
Pgap2 T A 7: 102,237,387 probably null Het
Pik3r6 T C 11: 68,533,696 W376R probably benign Het
Plekha2 T C 8: 25,088,397 Y29C probably damaging Het
Pms1 T C 1: 53,195,021 K779E probably damaging Het
Prss16 A G 13: 22,003,160 V98A probably damaging Het
Robo2 C T 16: 73,916,122 D1287N probably benign Het
Sgsm1 A G 5: 113,279,131 probably null Het
Slc40a1 A T 1: 45,925,262 M1K probably null Het
Smo A G 6: 29,756,814 H437R possibly damaging Het
Sult3a1 T C 10: 33,870,202 Y173H possibly damaging Het
Svep1 T A 4: 58,116,555 R898S possibly damaging Het
Synpo2l A G 14: 20,668,176 V7A probably damaging Het
Thsd1 C T 8: 22,258,553 A427V possibly damaging Het
Tnfrsf17 G A 16: 11,319,890 G164S probably benign Het
Zfp235 A G 7: 24,140,615 K153R probably damaging Het
Other mutations in Ces2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Ces2a APN 8 104741415 makesense probably null
IGL02135:Ces2a APN 8 104740181 missense probably benign 0.00
IGL02529:Ces2a APN 8 104737219 splice site probably benign
IGL02625:Ces2a APN 8 104740278 critical splice donor site probably null
IGL02869:Ces2a APN 8 104739059 missense probably damaging 1.00
IGL03265:Ces2a APN 8 104737443 missense possibly damaging 0.55
IGL03349:Ces2a APN 8 104734080 missense probably damaging 0.99
R0010:Ces2a UTSW 8 104741396 missense probably benign 0.00
R0318:Ces2a UTSW 8 104740824 missense probably damaging 1.00
R0477:Ces2a UTSW 8 104737537 missense probably damaging 0.99
R0561:Ces2a UTSW 8 104737533 missense probably benign 0.35
R0619:Ces2a UTSW 8 104736110 missense probably benign 0.00
R1665:Ces2a UTSW 8 104737555 splice site probably benign
R1737:Ces2a UTSW 8 104740824 missense probably damaging 0.98
R2266:Ces2a UTSW 8 104740190 missense probably benign 0.02
R2267:Ces2a UTSW 8 104740190 missense probably benign 0.02
R2269:Ces2a UTSW 8 104740190 missense probably benign 0.02
R2288:Ces2a UTSW 8 104737437 missense probably damaging 1.00
R2656:Ces2a UTSW 8 104736134 missense probably benign 0.00
R3176:Ces2a UTSW 8 104739378 splice site probably benign
R3906:Ces2a UTSW 8 104739308 missense probably benign 0.00
R4344:Ces2a UTSW 8 104737134 missense probably damaging 1.00
R4708:Ces2a UTSW 8 104737306 missense probably benign 0.14
R4780:Ces2a UTSW 8 104737208 missense probably damaging 1.00
R5434:Ces2a UTSW 8 104737409 missense probably damaging 0.98
R5763:Ces2a UTSW 8 104736124 missense probably benign 0.00
R5828:Ces2a UTSW 8 104739324 missense probably benign 0.00
R6359:Ces2a UTSW 8 104736078 missense probably benign 0.00
R7066:Ces2a UTSW 8 104740248 missense probably damaging 0.99
R7267:Ces2a UTSW 8 104739040 missense probably benign 0.20
R7395:Ces2a UTSW 8 104739641 missense probably benign 0.35
R7455:Ces2a UTSW 8 104737522 missense probably damaging 1.00
R7457:Ces2a UTSW 8 104737389 missense possibly damaging 0.87
R7567:Ces2a UTSW 8 104741298 missense probably benign 0.01
R7683:Ces2a UTSW 8 104737112 missense probably benign 0.00
X0022:Ces2a UTSW 8 104736142 missense probably damaging 1.00
Z1176:Ces2a UTSW 8 104734006 unclassified probably benign
Z1176:Ces2a UTSW 8 104734850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCTGCACATTTACTGTCCTAAC -3'
(R):5'- CATGTCTGGAAGGGCAAATG -3'

Sequencing Primer
(F):5'- TGTCCTAACCAAATAAGGGGATC -3'
(R):5'- TCTGGAAGGGCAAATGCTGATATTAG -3'
Posted On2018-05-24