Incidental Mutation 'R6440:Cdc25a'
ID518984
Institutional Source Beutler Lab
Gene Symbol Cdc25a
Ensembl Gene ENSMUSG00000032477
Gene Namecell division cycle 25A
SynonymsD9Ertd393e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6440 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location109875579-109893895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109881498 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 90 (I90T)
Ref Sequence ENSEMBL: ENSMUSP00000142958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094324] [ENSMUST00000198308] [ENSMUST00000198848]
Predicted Effect probably benign
Transcript: ENSMUST00000094324
AA Change: I151T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091882
Gene: ENSMUSG00000032477
AA Change: I151T

DomainStartEndE-ValueType
Pfam:M-inducer_phosp 85 318 3.6e-69 PFAM
RHOD 356 469 2.6e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197945
Predicted Effect probably benign
Transcript: ENSMUST00000198308
AA Change: I90T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142958
Gene: ENSMUSG00000032477
AA Change: I90T

DomainStartEndE-ValueType
Pfam:M-inducer_phosp 24 258 1.2e-88 PFAM
RHOD 295 408 5.97e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198848
Predicted Effect probably benign
Transcript: ENSMUST00000199787
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.7%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CDC25A is a member of the CDC25 family of phosphatases. CDC25A is required for progression from G1 to the S phase of the cell cycle. It activates the cyclin-dependent kinase CDC2 by removing two phosphate groups. CDC25A is specifically degraded in response to DNA damage, which prevents cells with chromosomal abnormalities from progressing through cell division. CDC25A is an oncogene, although its exact role in oncogenesis has not been demonstrated. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit elevated levels of early erythroid progenitor cell cycling but erythropoiesis is normally unaffected. Homozygous deletion of this gene is lethal and male heterozygotes display decreased vertebral trabecular bone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 T C 17: 55,794,744 probably null Het
Adgrl3 C T 5: 81,794,494 Q684* probably null Het
Ahi1 T A 10: 20,960,082 probably benign Het
Aox1 A G 1: 58,094,472 T1070A probably damaging Het
B3gnt9 C T 8: 105,253,899 probably null Het
C3ar1 G T 6: 122,850,508 A250E probably damaging Het
Caprin2 A G 6: 148,869,645 F284L probably damaging Het
Cdh9 A T 15: 16,823,423 T164S probably benign Het
Ces2a C T 8: 104,741,322 A528V probably benign Het
Cyp2c70 T C 19: 40,156,806 N402S possibly damaging Het
F3 A G 3: 121,725,037 E50G probably damaging Het
Fli1 A T 9: 32,423,901 S412T probably benign Het
Flt1 T A 5: 147,564,305 D1306V possibly damaging Het
Ggt7 T C 2: 155,498,811 D424G probably damaging Het
Gm5615 T A 9: 36,541,872 M1L probably benign Het
Grm7 A T 6: 111,254,020 N468I probably damaging Het
Htr5a T A 5: 27,850,872 V287E probably damaging Het
Map3k21 T C 8: 125,911,137 V154A probably damaging Het
Muc16 A G 9: 18,641,359 V4546A probably benign Het
Ncbp1 A G 4: 46,147,516 Y121C probably damaging Het
Nckap1l C A 15: 103,471,232 Y315* probably null Het
Ntpcr T A 8: 125,745,242 S64T probably damaging Het
Olfr376 A T 11: 73,375,347 E202D probably benign Het
Olfr811 A G 10: 129,801,968 S186P probably damaging Het
Olfr869 T C 9: 20,137,194 F26S probably damaging Het
Pde4dip A G 3: 97,767,586 C5R probably damaging Het
Pgap2 T A 7: 102,237,387 probably null Het
Pik3r6 T C 11: 68,533,696 W376R probably benign Het
Plekha2 T C 8: 25,088,397 Y29C probably damaging Het
Pms1 T C 1: 53,195,021 K779E probably damaging Het
Prss16 A G 13: 22,003,160 V98A probably damaging Het
Robo2 C T 16: 73,916,122 D1287N probably benign Het
Sgsm1 A G 5: 113,279,131 probably null Het
Slc40a1 A T 1: 45,925,262 M1K probably null Het
Smo A G 6: 29,756,814 H437R possibly damaging Het
Sult3a1 T C 10: 33,870,202 Y173H possibly damaging Het
Svep1 T A 4: 58,116,555 R898S possibly damaging Het
Synpo2l A G 14: 20,668,176 V7A probably damaging Het
Thsd1 C T 8: 22,258,553 A427V possibly damaging Het
Tnfrsf17 G A 16: 11,319,890 G164S probably benign Het
Zfp235 A G 7: 24,140,615 K153R probably damaging Het
Other mutations in Cdc25a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01658:Cdc25a APN 9 109876126 splice site probably null
IGL01761:Cdc25a APN 9 109891865 intron probably benign
IGL02808:Cdc25a APN 9 109883599 splice site probably null
IGL03241:Cdc25a APN 9 109884199 splice site probably null
P4748:Cdc25a UTSW 9 109884108 splice site probably benign
R1472:Cdc25a UTSW 9 109876089 missense probably benign 0.00
R1571:Cdc25a UTSW 9 109881546 missense possibly damaging 0.56
R1598:Cdc25a UTSW 9 109879893 frame shift probably null
R4135:Cdc25a UTSW 9 109881517 missense possibly damaging 0.62
R4301:Cdc25a UTSW 9 109889742 missense probably benign 0.23
R4386:Cdc25a UTSW 9 109889733 missense probably damaging 1.00
R5074:Cdc25a UTSW 9 109884140 missense possibly damaging 0.46
R5171:Cdc25a UTSW 9 109877161 missense probably benign 0.25
R5896:Cdc25a UTSW 9 109884365 missense probably benign 0.00
R5928:Cdc25a UTSW 9 109889793 missense probably damaging 1.00
R6223:Cdc25a UTSW 9 109889774 missense possibly damaging 0.85
R6240:Cdc25a UTSW 9 109884158 missense probably damaging 1.00
R6854:Cdc25a UTSW 9 109879927 missense probably damaging 1.00
R7219:Cdc25a UTSW 9 109889086 missense probably damaging 0.99
R7980:Cdc25a UTSW 9 109879881 missense probably damaging 1.00
R8506:Cdc25a UTSW 9 109891752 missense probably damaging 0.99
R8790:Cdc25a UTSW 9 109887348 critical splice donor site probably null
R8807:Cdc25a UTSW 9 109879235 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTAAGCCATCTCTCTAGACTCAAC -3'
(R):5'- TCCAGTTAATTCATAGGCCTCAGC -3'

Sequencing Primer
(F):5'- GCACATGAAGACAGGTCAGCTTTC -3'
(R):5'- ACAGGATTTCATGTAGCCCAGGC -3'
Posted On2018-05-24