Incidental Mutation 'R6440:Sult3a1'
ID518986
Institutional Source Beutler Lab
Gene Symbol Sult3a1
Ensembl Gene ENSMUSG00000069668
Gene Namesulfotransferase family 3A, member 1
SynonymsSultx2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R6440 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location33857721-33879532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33870202 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 173 (Y173H)
Ref Sequence ENSEMBL: ENSMUSP00000151228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092597] [ENSMUST00000218204]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092597
AA Change: Y173H

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090259
Gene: ENSMUSG00000069668
AA Change: Y173H

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 36 283 1.8e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217760
Predicted Effect possibly damaging
Transcript: ENSMUST00000218204
AA Change: Y173H

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.7%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 T C 17: 55,794,744 probably null Het
Adgrl3 C T 5: 81,794,494 Q684* probably null Het
Ahi1 T A 10: 20,960,082 probably benign Het
Aox1 A G 1: 58,094,472 T1070A probably damaging Het
B3gnt9 C T 8: 105,253,899 probably null Het
C3ar1 G T 6: 122,850,508 A250E probably damaging Het
Caprin2 A G 6: 148,869,645 F284L probably damaging Het
Cdc25a T C 9: 109,881,498 I90T probably benign Het
Cdh9 A T 15: 16,823,423 T164S probably benign Het
Ces2a C T 8: 104,741,322 A528V probably benign Het
Cyp2c70 T C 19: 40,156,806 N402S possibly damaging Het
F3 A G 3: 121,725,037 E50G probably damaging Het
Fli1 A T 9: 32,423,901 S412T probably benign Het
Flt1 T A 5: 147,564,305 D1306V possibly damaging Het
Ggt7 T C 2: 155,498,811 D424G probably damaging Het
Gm5615 T A 9: 36,541,872 M1L probably benign Het
Grm7 A T 6: 111,254,020 N468I probably damaging Het
Htr5a T A 5: 27,850,872 V287E probably damaging Het
Map3k21 T C 8: 125,911,137 V154A probably damaging Het
Muc16 A G 9: 18,641,359 V4546A probably benign Het
Ncbp1 A G 4: 46,147,516 Y121C probably damaging Het
Nckap1l C A 15: 103,471,232 Y315* probably null Het
Ntpcr T A 8: 125,745,242 S64T probably damaging Het
Olfr376 A T 11: 73,375,347 E202D probably benign Het
Olfr811 A G 10: 129,801,968 S186P probably damaging Het
Olfr869 T C 9: 20,137,194 F26S probably damaging Het
Pde4dip A G 3: 97,767,586 C5R probably damaging Het
Pgap2 T A 7: 102,237,387 probably null Het
Pik3r6 T C 11: 68,533,696 W376R probably benign Het
Plekha2 T C 8: 25,088,397 Y29C probably damaging Het
Pms1 T C 1: 53,195,021 K779E probably damaging Het
Prss16 A G 13: 22,003,160 V98A probably damaging Het
Robo2 C T 16: 73,916,122 D1287N probably benign Het
Sgsm1 A G 5: 113,279,131 probably null Het
Slc40a1 A T 1: 45,925,262 M1K probably null Het
Smo A G 6: 29,756,814 H437R possibly damaging Het
Svep1 T A 4: 58,116,555 R898S possibly damaging Het
Synpo2l A G 14: 20,668,176 V7A probably damaging Het
Thsd1 C T 8: 22,258,553 A427V possibly damaging Het
Tnfrsf17 G A 16: 11,319,890 G164S probably benign Het
Zfp235 A G 7: 24,140,615 K153R probably damaging Het
Other mutations in Sult3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01984:Sult3a1 APN 10 33879209 nonsense probably null
IGL02269:Sult3a1 APN 10 33879263 missense probably benign 0.25
IGL02302:Sult3a1 APN 10 33866575 missense possibly damaging 0.81
IGL02947:Sult3a1 APN 10 33864050 missense possibly damaging 0.92
IGL02966:Sult3a1 APN 10 33877273 splice site probably benign
IGL03271:Sult3a1 APN 10 33864001 missense probably benign
IGL03367:Sult3a1 APN 10 33877346 missense probably benign 0.01
R0539:Sult3a1 UTSW 10 33866523 missense probably damaging 1.00
R0627:Sult3a1 UTSW 10 33864014 missense probably benign 0.00
R0838:Sult3a1 UTSW 10 33879288 missense probably damaging 0.99
R1538:Sult3a1 UTSW 10 33870170 missense probably benign 0.29
R1604:Sult3a1 UTSW 10 33866620 missense probably damaging 1.00
R1622:Sult3a1 UTSW 10 33870250 missense probably benign 0.39
R3031:Sult3a1 UTSW 10 33877349 missense possibly damaging 0.70
R4933:Sult3a1 UTSW 10 33866554 missense probably damaging 1.00
R5943:Sult3a1 UTSW 10 33866641 missense probably damaging 0.99
R7140:Sult3a1 UTSW 10 33877287 missense probably damaging 1.00
R7356:Sult3a1 UTSW 10 33866583 missense probably benign 0.25
R8342:Sult3a1 UTSW 10 33866521 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAGTTAATTGTTCCCCAAACC -3'
(R):5'- GGAGAATGTGCTTTCAACCAAG -3'

Sequencing Primer
(F):5'- GTTAATTGTTCCCCAAACCACTAAAC -3'
(R):5'- AACTCTGGAGAGACTTGATGTCCC -3'
Posted On2018-05-24