Incidental Mutation 'R6440:Synpo2l'
ID518991
Institutional Source Beutler Lab
Gene Symbol Synpo2l
Ensembl Gene ENSMUSG00000039376
Gene Namesynaptopodin 2-like
Synonyms1110054M18Rik, Chap
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.525) question?
Stock #R6440 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location20658946-20668354 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20668176 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 7 (V7A)
Ref Sequence ENSEMBL: ENSMUSP00000112792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057090] [ENSMUST00000117386] [ENSMUST00000119483]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057090
AA Change: V7A

PolyPhen 2 Score 0.626 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000053176
Gene: ENSMUSG00000039376
AA Change: V7A

DomainStartEndE-ValueType
PDZ 15 85 3.52e-10 SMART
low complexity region 101 112 N/A INTRINSIC
low complexity region 151 162 N/A INTRINSIC
low complexity region 202 230 N/A INTRINSIC
low complexity region 243 257 N/A INTRINSIC
low complexity region 429 444 N/A INTRINSIC
low complexity region 500 518 N/A INTRINSIC
low complexity region 530 540 N/A INTRINSIC
low complexity region 563 580 N/A INTRINSIC
low complexity region 591 604 N/A INTRINSIC
low complexity region 700 726 N/A INTRINSIC
low complexity region 781 797 N/A INTRINSIC
low complexity region 867 880 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117386
AA Change: V7A

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112792
Gene: ENSMUSG00000039376
AA Change: V7A

DomainStartEndE-ValueType
PDZ 15 88 1.34e-15 SMART
low complexity region 104 115 N/A INTRINSIC
low complexity region 154 165 N/A INTRINSIC
low complexity region 205 233 N/A INTRINSIC
low complexity region 246 260 N/A INTRINSIC
low complexity region 432 447 N/A INTRINSIC
low complexity region 503 521 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 566 583 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
low complexity region 703 729 N/A INTRINSIC
low complexity region 784 800 N/A INTRINSIC
low complexity region 870 883 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119483
SMART Domains Protein: ENSMUSP00000112760
Gene: ENSMUSG00000039376

DomainStartEndE-ValueType
low complexity region 203 218 N/A INTRINSIC
low complexity region 274 292 N/A INTRINSIC
low complexity region 304 314 N/A INTRINSIC
low complexity region 337 354 N/A INTRINSIC
low complexity region 365 378 N/A INTRINSIC
low complexity region 474 500 N/A INTRINSIC
low complexity region 555 571 N/A INTRINSIC
low complexity region 641 654 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.7%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 T C 17: 55,794,744 probably null Het
Adgrl3 C T 5: 81,794,494 Q684* probably null Het
Ahi1 T A 10: 20,960,082 probably benign Het
Aox1 A G 1: 58,094,472 T1070A probably damaging Het
B3gnt9 C T 8: 105,253,899 probably null Het
C3ar1 G T 6: 122,850,508 A250E probably damaging Het
Caprin2 A G 6: 148,869,645 F284L probably damaging Het
Cdc25a T C 9: 109,881,498 I90T probably benign Het
Cdh9 A T 15: 16,823,423 T164S probably benign Het
Ces2a C T 8: 104,741,322 A528V probably benign Het
Cyp2c70 T C 19: 40,156,806 N402S possibly damaging Het
F3 A G 3: 121,725,037 E50G probably damaging Het
Fli1 A T 9: 32,423,901 S412T probably benign Het
Flt1 T A 5: 147,564,305 D1306V possibly damaging Het
Ggt7 T C 2: 155,498,811 D424G probably damaging Het
Gm5615 T A 9: 36,541,872 M1L probably benign Het
Grm7 A T 6: 111,254,020 N468I probably damaging Het
Htr5a T A 5: 27,850,872 V287E probably damaging Het
Map3k21 T C 8: 125,911,137 V154A probably damaging Het
Muc16 A G 9: 18,641,359 V4546A probably benign Het
Ncbp1 A G 4: 46,147,516 Y121C probably damaging Het
Nckap1l C A 15: 103,471,232 Y315* probably null Het
Ntpcr T A 8: 125,745,242 S64T probably damaging Het
Olfr376 A T 11: 73,375,347 E202D probably benign Het
Olfr811 A G 10: 129,801,968 S186P probably damaging Het
Olfr869 T C 9: 20,137,194 F26S probably damaging Het
Pde4dip A G 3: 97,767,586 C5R probably damaging Het
Pgap2 T A 7: 102,237,387 probably null Het
Pik3r6 T C 11: 68,533,696 W376R probably benign Het
Plekha2 T C 8: 25,088,397 Y29C probably damaging Het
Pms1 T C 1: 53,195,021 K779E probably damaging Het
Prss16 A G 13: 22,003,160 V98A probably damaging Het
Robo2 C T 16: 73,916,122 D1287N probably benign Het
Sgsm1 A G 5: 113,279,131 probably null Het
Slc40a1 A T 1: 45,925,262 M1K probably null Het
Smo A G 6: 29,756,814 H437R possibly damaging Het
Sult3a1 T C 10: 33,870,202 Y173H possibly damaging Het
Svep1 T A 4: 58,116,555 R898S possibly damaging Het
Thsd1 C T 8: 22,258,553 A427V possibly damaging Het
Tnfrsf17 G A 16: 11,319,890 G164S probably benign Het
Zfp235 A G 7: 24,140,615 K153R probably damaging Het
Other mutations in Synpo2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0048:Synpo2l UTSW 14 20666272 unclassified probably benign
R0277:Synpo2l UTSW 14 20661788 missense probably damaging 1.00
R0440:Synpo2l UTSW 14 20661398 missense possibly damaging 0.89
R0540:Synpo2l UTSW 14 20660680 missense probably damaging 1.00
R0607:Synpo2l UTSW 14 20660680 missense probably damaging 1.00
R0712:Synpo2l UTSW 14 20661839 missense probably damaging 1.00
R1175:Synpo2l UTSW 14 20668167 missense possibly damaging 0.93
R1563:Synpo2l UTSW 14 20661278 missense probably damaging 1.00
R1729:Synpo2l UTSW 14 20665819 missense probably damaging 1.00
R1730:Synpo2l UTSW 14 20665819 missense probably damaging 1.00
R1739:Synpo2l UTSW 14 20665819 missense probably damaging 1.00
R2199:Synpo2l UTSW 14 20661919 missense probably benign 0.00
R2213:Synpo2l UTSW 14 20660666 missense probably damaging 1.00
R3085:Synpo2l UTSW 14 20662180 missense probably damaging 1.00
R4787:Synpo2l UTSW 14 20661697 missense possibly damaging 0.49
R5256:Synpo2l UTSW 14 20661014 missense probably benign 0.00
R5454:Synpo2l UTSW 14 20662292 missense probably damaging 0.99
R5455:Synpo2l UTSW 14 20662292 missense probably damaging 0.99
R5765:Synpo2l UTSW 14 20666130 missense possibly damaging 0.95
R5950:Synpo2l UTSW 14 20665935 missense probably benign 0.00
R6376:Synpo2l UTSW 14 20660634 missense probably damaging 1.00
R6438:Synpo2l UTSW 14 20661136 missense probably benign 0.00
R6511:Synpo2l UTSW 14 20662450 missense probably damaging 1.00
R6834:Synpo2l UTSW 14 20660634 missense probably damaging 1.00
R7735:Synpo2l UTSW 14 20661175 missense possibly damaging 0.88
Z1088:Synpo2l UTSW 14 20665967 missense probably damaging 0.99
Z1177:Synpo2l UTSW 14 20660504 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGAGCATGCTTACCTGCCC -3'
(R):5'- TGTACTGGACTGTACCGATCCC -3'

Sequencing Primer
(F):5'- TTCTTCACAAAACCCCACTCTG -3'
(R):5'- ATCCCAGGGCCAAGTTGC -3'
Posted On2018-05-24