Incidental Mutation 'R6441:Cpb1'
ID519003
Institutional Source Beutler Lab
Gene Symbol Cpb1
Ensembl Gene ENSMUSG00000011463
Gene Namecarboxypeptidase B1 (tissue)
Synonyms1810063F02Rik, 0910001A18Rik, 2210008M23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6441 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location20248264-20275733 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20249814 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 362 (D362G)
Ref Sequence ENSEMBL: ENSMUSP00000011607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011607]
Predicted Effect probably damaging
Transcript: ENSMUST00000011607
AA Change: D362G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000011607
Gene: ENSMUSG00000011463
AA Change: D362G

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Propep_M14 26 102 2.4e-19 PFAM
Zn_pept 117 398 2.08e-147 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125945
Meta Mutation Damage Score 0.9108 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Three different procarboxypeptidases A and two different procarboxypeptidases B have been isolated. The B1 and B2 forms differ from each other mainly in isoelectric point. Carboxypeptidase B1 is a highly tissue-specific protein and is a useful serum marker for acute pancreatitis and dysfunction of pancreatic transplants. It is not elevated in pancreatic carcinoma. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl A T 3: 116,771,459 M1047K probably benign Het
Apob A T 12: 7,987,796 D322V probably damaging Het
Capn12 T A 7: 28,888,002 C438S probably benign Het
Cdh23 A T 10: 60,308,036 V2932E probably damaging Het
Cdh9 A T 15: 16,823,423 T164S probably benign Het
CN725425 T C 15: 91,235,802 V42A probably benign Het
Csmd2 C A 4: 128,394,964 Q1099K probably benign Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Galnt4 A G 10: 99,110,098 M562V possibly damaging Het
Gtf3c3 T A 1: 54,406,038 E619V probably benign Het
Gucy2c A T 6: 136,723,761 M585K probably damaging Het
Hmcn1 A G 1: 150,703,216 I1993T possibly damaging Het
Lonrf2 T C 1: 38,818,123 E44G possibly damaging Het
Lrit3 A T 3: 129,800,360 F189L probably benign Het
Mag T C 7: 30,907,083 N310D possibly damaging Het
Mccc2 T C 13: 99,954,676 T151A probably damaging Het
Mybpc1 A T 10: 88,553,277 S49T probably benign Het
Myh2 A G 11: 67,194,611 E1787G probably benign Het
Ncapd3 A G 9: 27,063,416 D728G probably benign Het
Nup37 A G 10: 88,160,937 E139G probably benign Het
Odf3 T C 7: 140,849,248 S149P probably damaging Het
Olfr651 C T 7: 104,553,335 Q139* probably null Het
Pcdhgb5 A G 18: 37,732,085 Y311C probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Rbm44 A T 1: 91,157,077 N674Y probably damaging Het
Ryr1 T C 7: 29,059,695 I3353V possibly damaging Het
Sema3c C T 5: 17,724,132 T588I possibly damaging Het
Sh2d5 A T 4: 138,259,082 E372V possibly damaging Het
Slc27a6 C T 18: 58,572,058 P171S probably benign Het
Slfn3 C T 11: 83,214,914 T579I probably benign Het
Svil T G 18: 5,049,323 V287G probably benign Het
Tas1r2 T A 4: 139,669,156 V602D probably damaging Het
Tln2 A G 9: 67,272,689 L800P probably damaging Het
Trim31 C A 17: 36,907,791 Q323K possibly damaging Het
Txndc9 T A 1: 37,990,218 D183V possibly damaging Het
Vmn2r28 T A 7: 5,488,475 M258L probably benign Het
Vmn2r75 A T 7: 86,171,576 I50N probably damaging Het
Zgrf1 A T 3: 127,588,034 N1161Y possibly damaging Het
Other mutations in Cpb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Cpb1 APN 3 20252029 missense probably benign 0.00
IGL01061:Cpb1 APN 3 20266516 missense probably benign 0.06
IGL01376:Cpb1 APN 3 20270324 missense probably benign 0.00
IGL01409:Cpb1 APN 3 20249805 missense possibly damaging 0.51
IGL01505:Cpb1 APN 3 20266246 missense probably damaging 1.00
IGL01599:Cpb1 APN 3 20251954 critical splice donor site probably null
IGL01672:Cpb1 APN 3 20275421 missense probably null 0.34
IGL02421:Cpb1 APN 3 20251984 missense probably damaging 1.00
IGL02685:Cpb1 APN 3 20265356 missense probably damaging 1.00
IGL02825:Cpb1 APN 3 20249725 missense probably damaging 1.00
IGL02929:Cpb1 APN 3 20275466 missense probably benign 0.00
IGL03229:Cpb1 APN 3 20249837 nonsense probably null
R0106:Cpb1 UTSW 3 20266533 splice site probably null
R0106:Cpb1 UTSW 3 20266533 splice site probably null
R0485:Cpb1 UTSW 3 20275628 missense unknown
R0609:Cpb1 UTSW 3 20262474 missense probably damaging 1.00
R0622:Cpb1 UTSW 3 20249818 missense probably damaging 1.00
R0676:Cpb1 UTSW 3 20266533 splice site probably null
R0829:Cpb1 UTSW 3 20251943 splice site probably benign
R0981:Cpb1 UTSW 3 20275490 missense probably benign 0.29
R1496:Cpb1 UTSW 3 20263532 missense probably damaging 0.99
R1535:Cpb1 UTSW 3 20266287 missense probably benign 0.19
R1607:Cpb1 UTSW 3 20263782 missense probably benign 0.03
R1707:Cpb1 UTSW 3 20275491 missense probably damaging 0.99
R1753:Cpb1 UTSW 3 20266241 missense possibly damaging 0.67
R1866:Cpb1 UTSW 3 20263756 missense probably benign 0.00
R2177:Cpb1 UTSW 3 20266447 missense probably benign 0.41
R2234:Cpb1 UTSW 3 20275465 missense probably benign 0.04
R3110:Cpb1 UTSW 3 20265357 missense probably damaging 1.00
R3112:Cpb1 UTSW 3 20265357 missense probably damaging 1.00
R4353:Cpb1 UTSW 3 20262544 missense probably benign 0.07
R4405:Cpb1 UTSW 3 20263569 missense probably benign 0.00
R4485:Cpb1 UTSW 3 20249701 missense probably benign 0.00
R4734:Cpb1 UTSW 3 20263712 missense probably benign 0.43
R4984:Cpb1 UTSW 3 20270352 frame shift probably null
R5807:Cpb1 UTSW 3 20263742 missense probably damaging 0.98
R6377:Cpb1 UTSW 3 20275584 critical splice donor site probably null
R7175:Cpb1 UTSW 3 20263763 missense probably benign 0.00
R7488:Cpb1 UTSW 3 20270324 missense possibly damaging 0.46
R8288:Cpb1 UTSW 3 20265367 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAGATTCTTCACTAATATGGATGCTC -3'
(R):5'- AGATGCCCACAGTGGACTTC -3'

Sequencing Primer
(F):5'- ATGGATGCTCTAGGACATAATTGGC -3'
(R):5'- GTGGACTTCCCCCTACACATAAGTG -3'
Posted On2018-05-24