Incidental Mutation 'R6441:Lrit3'
ID519006
Institutional Source Beutler Lab
Gene Symbol Lrit3
Ensembl Gene ENSMUSG00000093865
Gene Nameleucine-rich repeat, immunoglobulin-like and transmembrane domains 3
SynonymsLOC242235
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6441 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location129787881-129804030 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129800360 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 189 (F189L)
Ref Sequence ENSEMBL: ENSMUSP00000140184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171313] [ENSMUST00000179187] [ENSMUST00000185462]
Predicted Effect probably benign
Transcript: ENSMUST00000171313
SMART Domains Protein: ENSMUSP00000132360
Gene: ENSMUSG00000028012

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 36 309 3.5e-11 PFAM
Pfam:7tm_1 42 294 4.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179187
AA Change: F189L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136912
Gene: ENSMUSG00000093865
AA Change: F189L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 20 61 2.7e-1 SMART
LRR 80 103 6.96e0 SMART
LRR 104 127 3.27e1 SMART
LRR_TYP 128 151 4.47e-3 SMART
LRR_TYP 152 175 7.37e-4 SMART
LRRCT 201 252 4.65e-2 SMART
Blast:IG 260 297 9e-13 BLAST
low complexity region 298 311 N/A INTRINSIC
FN3 364 443 1.85e0 SMART
transmembrane domain 462 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185462
AA Change: F189L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140184
Gene: ENSMUSG00000093865
AA Change: F189L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 20 61 1.3e-3 SMART
LRR 80 103 2.9e-2 SMART
LRR 104 127 1.4e-1 SMART
LRR_TYP 128 151 1.9e-5 SMART
LRR_TYP 152 175 3.2e-6 SMART
LRRCT 201 252 2.3e-4 SMART
IGc2 266 335 4.7e-11 SMART
low complexity region 340 352 N/A INTRINSIC
low complexity region 362 376 N/A INTRINSIC
low complexity region 408 432 N/A INTRINSIC
FN3 485 564 9e-3 SMART
transmembrane domain 583 605 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196317
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a fibronectin type III domain and a C-terminal transmembrane domain, as well as a leucine-rich repeat domain and immunoglobulin-like domain near the N-terminus. The encoded protein may regulate fibroblast growth factor receptors and affect the modification of these receptors, which are glycosylated differently in the Golgi and endoplasmic reticulum. Mutations in this gene are associated with congenital stationary night blindness, type 1F. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a targeted allele show a selective absence of the ERG b-wave with a normal a-wave component under scotopic conditions, as well as variable ERG responses with larger a-wave amplitudes, shorter b-wave amplitudes, and longer implicit times of both waves under photopic conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl A T 3: 116,771,459 M1047K probably benign Het
Apob A T 12: 7,987,796 D322V probably damaging Het
Capn12 T A 7: 28,888,002 C438S probably benign Het
Cdh23 A T 10: 60,308,036 V2932E probably damaging Het
Cdh9 A T 15: 16,823,423 T164S probably benign Het
CN725425 T C 15: 91,235,802 V42A probably benign Het
Cpb1 T C 3: 20,249,814 D362G probably damaging Het
Csmd2 C A 4: 128,394,964 Q1099K probably benign Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Galnt4 A G 10: 99,110,098 M562V possibly damaging Het
Gtf3c3 T A 1: 54,406,038 E619V probably benign Het
Gucy2c A T 6: 136,723,761 M585K probably damaging Het
Hmcn1 A G 1: 150,703,216 I1993T possibly damaging Het
Lonrf2 T C 1: 38,818,123 E44G possibly damaging Het
Mag T C 7: 30,907,083 N310D possibly damaging Het
Mccc2 T C 13: 99,954,676 T151A probably damaging Het
Mybpc1 A T 10: 88,553,277 S49T probably benign Het
Myh2 A G 11: 67,194,611 E1787G probably benign Het
Ncapd3 A G 9: 27,063,416 D728G probably benign Het
Nup37 A G 10: 88,160,937 E139G probably benign Het
Odf3 T C 7: 140,849,248 S149P probably damaging Het
Olfr651 C T 7: 104,553,335 Q139* probably null Het
Pcdhgb5 A G 18: 37,732,085 Y311C probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Rbm44 A T 1: 91,157,077 N674Y probably damaging Het
Ryr1 T C 7: 29,059,695 I3353V possibly damaging Het
Sema3c C T 5: 17,724,132 T588I possibly damaging Het
Sh2d5 A T 4: 138,259,082 E372V possibly damaging Het
Slc27a6 C T 18: 58,572,058 P171S probably benign Het
Slfn3 C T 11: 83,214,914 T579I probably benign Het
Svil T G 18: 5,049,323 V287G probably benign Het
Tas1r2 T A 4: 139,669,156 V602D probably damaging Het
Tln2 A G 9: 67,272,689 L800P probably damaging Het
Trim31 C A 17: 36,907,791 Q323K possibly damaging Het
Txndc9 T A 1: 37,990,218 D183V possibly damaging Het
Vmn2r28 T A 7: 5,488,475 M258L probably benign Het
Vmn2r75 A T 7: 86,171,576 I50N probably damaging Het
Zgrf1 A T 3: 127,588,034 N1161Y possibly damaging Het
Other mutations in Lrit3
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Lrit3 UTSW 3 129788819 small insertion probably benign
FR4340:Lrit3 UTSW 3 129788808 small insertion probably benign
FR4548:Lrit3 UTSW 3 129788813 small insertion probably benign
FR4548:Lrit3 UTSW 3 129788816 small insertion probably benign
FR4589:Lrit3 UTSW 3 129803913 frame shift probably null
FR4737:Lrit3 UTSW 3 129788806 small insertion probably benign
FR4737:Lrit3 UTSW 3 129788810 small insertion probably benign
FR4737:Lrit3 UTSW 3 129803913 frame shift probably null
FR4976:Lrit3 UTSW 3 129803910 unclassified probably benign
R0555:Lrit3 UTSW 3 129791296 missense probably damaging 1.00
R0629:Lrit3 UTSW 3 129788302 missense probably damaging 1.00
R0631:Lrit3 UTSW 3 129788555 missense probably damaging 1.00
R1690:Lrit3 UTSW 3 129800745 missense probably damaging 0.99
R1902:Lrit3 UTSW 3 129791246 missense probably benign 0.17
R1955:Lrit3 UTSW 3 129800481 missense probably benign 0.11
R3155:Lrit3 UTSW 3 129791395 missense probably benign 0.00
R4005:Lrit3 UTSW 3 129791372 missense probably benign 0.14
R4445:Lrit3 UTSW 3 129788531 nonsense probably null
R4675:Lrit3 UTSW 3 129788472 missense probably damaging 1.00
R5104:Lrit3 UTSW 3 129788391 missense possibly damaging 0.86
R5147:Lrit3 UTSW 3 129803925 missense possibly damaging 0.78
R5271:Lrit3 UTSW 3 129788301 missense probably damaging 1.00
R5505:Lrit3 UTSW 3 129791438 missense possibly damaging 0.83
R5587:Lrit3 UTSW 3 129788898 missense probably benign 0.25
R6056:Lrit3 UTSW 3 129789355 missense probably damaging 1.00
R6239:Lrit3 UTSW 3 129800346 missense probably damaging 0.98
R6280:Lrit3 UTSW 3 129788763 missense probably damaging 0.99
R6305:Lrit3 UTSW 3 129800460 missense probably damaging 0.98
R6947:Lrit3 UTSW 3 129789234 missense probably benign 0.01
R6949:Lrit3 UTSW 3 129789285 missense probably damaging 1.00
R7850:Lrit3 UTSW 3 129800803 missense probably damaging 1.00
R7933:Lrit3 UTSW 3 129800803 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGCAGGTGTAAGATCCCAGG -3'
(R):5'- GATGGGAATTCTCTGACCGC -3'

Sequencing Primer
(F):5'- GTGTAAGATCCCAGGTTAGATCCC -3'
(R):5'- GTGTCTCTGCTGGACATGCC -3'
Posted On2018-05-24