Mutagenetix > Incidental Mutation

Incidental Mutation 'R6441:Csmd2'

519007

Institutional Source

Beutler Lab

Gene Symbol

Csmd2

Ensembl Gene

ENSMUSG00000028804

Gene Name

CUB and Sushi multiple domains 2

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R6441 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

127987857-128567656 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 128394964 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 1099 (Q1099K)

Ref Sequence

ENSEMBL: ENSMUSP00000138958 (fasta)

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144298

Predicted Effect

probably benign
Transcript: ENSMUST00000184063
AA Change: Q1099K

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

Meta Mutation Damage Score

0.1219

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agl	A	T	3: 116,771,459	M1047K	probably benign	Het
Apob	A	T	12: 7,987,796	D322V	probably damaging	Het
Capn12	T	A	7: 28,888,002	C438S	probably benign	Het
Cdh23	A	T	10: 60,308,036	V2932E	probably damaging	Het
Cdh9	A	T	15: 16,823,423	T164S	probably benign	Het
CN725425	T	C	15: 91,235,802	V42A	probably benign	Het
Cpb1	T	C	3: 20,249,814	D362G	probably damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Galnt4	A	G	10: 99,110,098	M562V	possibly damaging	Het
Gtf3c3	T	A	1: 54,406,038	E619V	probably benign	Het
Gucy2c	A	T	6: 136,723,761	M585K	probably damaging	Het
Hmcn1	A	G	1: 150,703,216	I1993T	possibly damaging	Het
Lonrf2	T	C	1: 38,818,123	E44G	possibly damaging	Het
Lrit3	A	T	3: 129,800,360	F189L	probably benign	Het
Mag	T	C	7: 30,907,083	N310D	possibly damaging	Het
Mccc2	T	C	13: 99,954,676	T151A	probably damaging	Het
Mybpc1	A	T	10: 88,553,277	S49T	probably benign	Het
Myh2	A	G	11: 67,194,611	E1787G	probably benign	Het
Ncapd3	A	G	9: 27,063,416	D728G	probably benign	Het
Nup37	A	G	10: 88,160,937	E139G	probably benign	Het
Odf3	T	C	7: 140,849,248	S149P	probably damaging	Het
Olfr651	C	T	7: 104,553,335	Q139*	probably null	Het
Pcdhgb5	A	G	18: 37,732,085	Y311C	probably damaging	Het
Pls1	A	G	9: 95,754,745	I558T	probably damaging	Het
Rbm44	A	T	1: 91,157,077	N674Y	probably damaging	Het
Ryr1	T	C	7: 29,059,695	I3353V	possibly damaging	Het
Sema3c	C	T	5: 17,724,132	T588I	possibly damaging	Het
Sh2d5	A	T	4: 138,259,082	E372V	possibly damaging	Het
Slc27a6	C	T	18: 58,572,058	P171S	probably benign	Het
Slfn3	C	T	11: 83,214,914	T579I	probably benign	Het
Svil	T	G	18: 5,049,323	V287G	probably benign	Het
Tas1r2	T	A	4: 139,669,156	V602D	probably damaging	Het
Tln2	A	G	9: 67,272,689	L800P	probably damaging	Het
Trim31	C	A	17: 36,907,791	Q323K	possibly damaging	Het
Txndc9	T	A	1: 37,990,218	D183V	possibly damaging	Het
Vmn2r28	T	A	7: 5,488,475	M258L	probably benign	Het
Vmn2r75	A	T	7: 86,171,576	I50N	probably damaging	Het
Zgrf1	A	T	3: 127,588,034	N1161Y	possibly damaging	Het

Other mutations in Csmd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00519:Csmd2	APN	4	128483473	missense	probably benign	0.03
IGL01098:Csmd2	APN	4	128059052	missense	probably damaging	0.99
IGL01114:Csmd2	APN	4	128369130	missense	probably benign	0.04
IGL01364:Csmd2	APN	4	128414288	missense	probably benign	0.01
IGL01530:Csmd2	APN	4	128414301	missense	possibly damaging	0.66
IGL01582:Csmd2	APN	4	128563305	nonsense	probably null
IGL01670:Csmd2	APN	4	128513371	splice site	probably benign
IGL01707:Csmd2	APN	4	128383005	missense	possibly damaging	0.81
IGL01810:Csmd2	APN	4	128480845	splice site	probably benign
IGL01837:Csmd2	APN	4	128419570	missense	possibly damaging	0.92
IGL01924:Csmd2	APN	4	128559947	missense	unknown
IGL02013:Csmd2	APN	4	128321323	missense	possibly damaging	0.47
IGL02020:Csmd2	APN	4	128559879	missense	probably damaging	1.00
IGL02037:Csmd2	APN	4	128477470	splice site	probably benign
IGL02303:Csmd2	APN	4	128369008	missense	probably benign	0.01
IGL02317:Csmd2	APN	4	128463727	splice site	probably benign
IGL02322:Csmd2	APN	4	128463727	splice site	probably benign
IGL02338:Csmd2	APN	4	128395066	missense	possibly damaging	0.79
IGL02412:Csmd2	APN	4	128513372	splice site	probably benign
IGL02428:Csmd2	APN	4	128474816	missense	possibly damaging	0.82
IGL02491:Csmd2	APN	4	128534257	missense	probably benign
IGL02701:Csmd2	APN	4	128496141	missense	probably benign	0.17
IGL02801:Csmd2	APN	4	128552075	splice site	probably null
IGL02818:Csmd2	APN	4	128209728	missense	probably damaging	1.00
IGL02863:Csmd2	APN	4	128521884	missense	probably benign	0.00
IGL02876:Csmd2	APN	4	128321335	nonsense	probably null
IGL02977:Csmd2	APN	4	128493276	nonsense	probably null
IGL03006:Csmd2	APN	4	128480765	splice site	probably benign
IGL03032:Csmd2	APN	4	128519041	missense	probably benign	0.03
IGL03148:Csmd2	APN	4	128384269	missense	probably damaging	1.00
IGL03157:Csmd2	APN	4	128414299	nonsense	probably null
IGL03245:Csmd2	APN	4	128509122	missense	probably benign	0.12
IGL03376:Csmd2	APN	4	128517671	missense	probably benign	0.03
IGL03014:Csmd2	UTSW	4	128296429	missense	probably benign	0.01
R0109:Csmd2	UTSW	4	128544743	missense	probably benign	0.03
R0112:Csmd2	UTSW	4	128496029	missense	probably damaging	1.00
R0157:Csmd2	UTSW	4	128521911	missense	probably benign	0.02
R0390:Csmd2	UTSW	4	128133673	intron	probably benign
R0441:Csmd2	UTSW	4	128520230	missense	probably benign	0.00
R0519:Csmd2	UTSW	4	128487005	missense	possibly damaging	0.95
R0743:Csmd2	UTSW	4	128113676	missense	probably benign	0.00
R0746:Csmd2	UTSW	4	128414297	missense	probably damaging	1.00
R0973:Csmd2	UTSW	4	128496188	missense	possibly damaging	0.91
R1019:Csmd2	UTSW	4	128522014	missense	probably benign	0.00
R1476:Csmd2	UTSW	4	128487001	missense	probably benign	0.08
R1641:Csmd2	UTSW	4	128483395	missense	possibly damaging	0.68
R1709:Csmd2	UTSW	4	128496195	missense	probably damaging	0.96
R2866:Csmd2	UTSW	4	128414392	critical splice donor site	probably null
R2870:Csmd2	UTSW	4	128557718	missense	unknown
R2870:Csmd2	UTSW	4	128557718	missense	unknown
R2871:Csmd2	UTSW	4	128557718	missense	unknown
R2871:Csmd2	UTSW	4	128557718	missense	unknown
R2872:Csmd2	UTSW	4	128557718	missense	unknown
R2872:Csmd2	UTSW	4	128557718	missense	unknown
R2873:Csmd2	UTSW	4	128557718	missense	unknown
R2893:Csmd2	UTSW	4	128538993	splice site	probably null
R3796:Csmd2	UTSW	4	128517595	missense	probably benign	0.20
R3797:Csmd2	UTSW	4	128517595	missense	probably benign	0.20
R3798:Csmd2	UTSW	4	128517595	missense	probably benign	0.20
R3914:Csmd2	UTSW	4	128321324	missense	probably benign	0.07
R4198:Csmd2	UTSW	4	128510924	missense	probably benign	0.07
R4489:Csmd2	UTSW	4	128381945	missense	possibly damaging	0.68
R4571:Csmd2	UTSW	4	128480095	splice site	probably null
R4581:Csmd2	UTSW	4	128369088	missense	probably benign	0.02
R4599:Csmd2	UTSW	4	127988128	missense	probably benign	0.35
R4649:Csmd2	UTSW	4	128546073	missense	probably benign
R4706:Csmd2	UTSW	4	128544751	missense	probably benign
R4776:Csmd2	UTSW	4	128442892	missense	probably benign	0.09
R4838:Csmd2	UTSW	4	128517749	missense	probably benign
R4900:Csmd2	UTSW	4	128452525	missense	probably benign	0.03
R4999:Csmd2	UTSW	4	128521930	missense	probably benign	0.00
R5024:Csmd2	UTSW	4	128321348	missense	possibly damaging	0.94
R5034:Csmd2	UTSW	4	128059108	missense	probably damaging	0.98
R5152:Csmd2	UTSW	4	128552035	missense	probably benign	0.27
R5172:Csmd2	UTSW	4	128477397	missense	probably benign	0.10
R5231:Csmd2	UTSW	4	128546049	missense	probably benign	0.00
R5279:Csmd2	UTSW	4	128456914	missense	probably benign	0.30
R5287:Csmd2	UTSW	4	128486884	missense	probably benign	0.01
R5403:Csmd2	UTSW	4	128486884	missense	probably benign	0.01
R5410:Csmd2	UTSW	4	128548819	missense	probably benign
R5551:Csmd2	UTSW	4	128510948	missense	possibly damaging	0.83
R5566:Csmd2	UTSW	4	128462889	critical splice donor site	probably null
R5826:Csmd2	UTSW	4	128519199	splice site	probably null
R5907:Csmd2	UTSW	4	128197385	missense	probably damaging	0.99
R5913:Csmd2	UTSW	4	128551988	missense	probably benign	0.01
R5970:Csmd2	UTSW	4	128546151	missense	probably benign	0.00
R5977:Csmd2	UTSW	4	128059034	missense	probably damaging	1.00
R6027:Csmd2	UTSW	4	128559946	missense	unknown
R6075:Csmd2	UTSW	4	128486865	missense	probably benign	0.15
R6129:Csmd2	UTSW	4	128493334	missense	possibly damaging	0.79
R6363:Csmd2	UTSW	4	128400379	missense	probably benign	0.00
R6366:Csmd2	UTSW	4	128483452	missense	probably benign	0.00
R6404:Csmd2	UTSW	4	128521950	missense	possibly damaging	0.90
R6437:Csmd2	UTSW	4	127988100	missense	probably benign	0.24
R6643:Csmd2	UTSW	4	128372597	missense	probably benign	0.14
R6724:Csmd2	UTSW	4	128563371	missense	probably damaging	0.97
R6734:Csmd2	UTSW	4	128463813	missense	probably benign	0.00
R6750:Csmd2	UTSW	4	128197225	missense	possibly damaging	0.91
R6801:Csmd2	UTSW	4	128383950	missense	probably benign	0.11
R6842:Csmd2	UTSW	4	128509159	missense	possibly damaging	0.72
R6843:Csmd2	UTSW	4	128463794	missense	probably benign	0.27
R6868:Csmd2	UTSW	4	128442840	missense	probably benign
R6882:Csmd2	UTSW	4	128449269	missense	probably benign	0.01
R7019:Csmd2	UTSW	4	128369063	missense
R7028:Csmd2	UTSW	4	128277228	missense
R7096:Csmd2	UTSW	4	128462726	missense
R7122:Csmd2	UTSW	4	128449227	missense
R7125:Csmd2	UTSW	4	128496162	missense
R7197:Csmd2	UTSW	4	128511033	missense
R7234:Csmd2	UTSW	4	128456779	missense
R7299:Csmd2	UTSW	4	128528262	missense
R7301:Csmd2	UTSW	4	128528262	missense
R7319:Csmd2	UTSW	4	128393679	missense
R7331:Csmd2	UTSW	4	128564228	splice site	probably null
R7332:Csmd2	UTSW	4	128419567	missense
R7352:Csmd2	UTSW	4	128557636	missense
R7402:Csmd2	UTSW	4	128322095	missense
R7402:Csmd2	UTSW	4	128322096	missense
R7474:Csmd2	UTSW	4	128546127	missense
R7555:Csmd2	UTSW	4	128452458	missense
R7592:Csmd2	UTSW	4	128463798	missense
R7700:Csmd2	UTSW	4	128545756	splice site	probably null
R7714:Csmd2	UTSW	4	128382950	nonsense	probably null
R7734:Csmd2	UTSW	4	128552057	missense
R7735:Csmd2	UTSW	4	128456930	critical splice donor site	probably null
R7757:Csmd2	UTSW	4	128483456	missense
R7805:Csmd2	UTSW	4	128419573	missense
R7823:Csmd2	UTSW	4	128209905	missense
R7904:Csmd2	UTSW	4	128419553	missense
R7946:Csmd2	UTSW	4	128520265	missense
R7964:Csmd2	UTSW	4	128523510	missense
R7968:Csmd2	UTSW	4	128197325	missense
R8003:Csmd2	UTSW	4	128539187	nonsense	probably null
R8071:Csmd2	UTSW	4	128393538	missense
R8504:Csmd2	UTSW	4	128546690	missense
R8511:Csmd2	UTSW	4	128368899	missense
R8517:Csmd2	UTSW	4	128552686	missense
R8704:Csmd2	UTSW	4	128197354	missense
R8722:Csmd2	UTSW	4	128551950	unclassified	probably benign
R8729:Csmd2	UTSW	4	128462845	missense
R8801:Csmd2	UTSW	4	128563402	missense	probably damaging	0.97
R8803:Csmd2	UTSW	4	128546684	missense
R8839:Csmd2	UTSW	4	128442888	missense
R8867:Csmd2	UTSW	4	128557676	missense
R8913:Csmd2	UTSW	4	128523558	missense
R8928:Csmd2	UTSW	4	128475789	missense
R8974:Csmd2	UTSW	4	128552587	missense
R9001:Csmd2	UTSW	4	128414286	missense
R9132:Csmd2	UTSW	4	128549214	missense
R9245:Csmd2	UTSW	4	128306375	missense
R9249:Csmd2	UTSW	4	128419530	nonsense	probably null
R9254:Csmd2	UTSW	4	128197319	missense
R9265:Csmd2	UTSW	4	128400370	missense
R9407:Csmd2	UTSW	4	128548820	missense
R9432:Csmd2	UTSW	4	128277211	missense
R9559:Csmd2	UTSW	4	128544768	missense
R9673:Csmd2	UTSW	4	128414269	missense
R9735:Csmd2	UTSW	4	128509108	missense
R9749:Csmd2	UTSW	4	128496128	missense
R9803:Csmd2	UTSW	4	128369193	missense
Z1177:Csmd2	UTSW	4	128530797	missense

Predicted Primers

PCR Primer
(F):5'- AGCTAGCACGCTGTAGTCTC -3'
(R):5'- ACTGTATGGATCCTCAACCCAG -3'

Sequencing Primer
(F):5'- TCTGCAGAGTATGACCTG -3'
(R):5'- GCTCTAAGTTTGGCCCGC -3'

Posted On

2018-05-24