Incidental Mutation 'R6441:Csmd2'
ID 519007
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene Name CUB and Sushi multiple domains 2
Synonyms
MMRRC Submission 044579-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.111) question?
Stock # R6441 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 127881650-128461449 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 128288757 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 1099 (Q1099K)
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000184063]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144298
Predicted Effect probably benign
Transcript: ENSMUST00000184063
AA Change: Q1099K

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.1219 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl A T 3: 116,565,108 (GRCm39) M1047K probably benign Het
Apob A T 12: 8,037,796 (GRCm39) D322V probably damaging Het
Capn12 T A 7: 28,587,427 (GRCm39) C438S probably benign Het
Cdh23 A T 10: 60,143,815 (GRCm39) V2932E probably damaging Het
Cdh9 A T 15: 16,823,509 (GRCm39) T164S probably benign Het
Cimap1a T C 7: 140,429,161 (GRCm39) S149P probably damaging Het
CN725425 T C 15: 91,120,005 (GRCm39) V42A probably benign Het
Cpb1 T C 3: 20,303,978 (GRCm39) D362G probably damaging Het
D6Ertd527e C G 6: 87,088,506 (GRCm39) T223S unknown Het
Galnt4 A G 10: 98,945,960 (GRCm39) M562V possibly damaging Het
Gtf3c3 T A 1: 54,445,197 (GRCm39) E619V probably benign Het
Gucy2c A T 6: 136,700,759 (GRCm39) M585K probably damaging Het
Hmcn1 A G 1: 150,578,967 (GRCm39) I1993T possibly damaging Het
Lonrf2 T C 1: 38,857,204 (GRCm39) E44G possibly damaging Het
Lrit3 A T 3: 129,594,009 (GRCm39) F189L probably benign Het
Mag T C 7: 30,606,508 (GRCm39) N310D possibly damaging Het
Mccc2 T C 13: 100,091,184 (GRCm39) T151A probably damaging Het
Mybpc1 A T 10: 88,389,139 (GRCm39) S49T probably benign Het
Myh2 A G 11: 67,085,437 (GRCm39) E1787G probably benign Het
Ncapd3 A G 9: 26,974,712 (GRCm39) D728G probably benign Het
Nup37 A G 10: 87,996,799 (GRCm39) E139G probably benign Het
Or52h9 C T 7: 104,202,542 (GRCm39) Q139* probably null Het
Pcdhgb5 A G 18: 37,865,138 (GRCm39) Y311C probably damaging Het
Pls1 A G 9: 95,636,798 (GRCm39) I558T probably damaging Het
Rbm44 A T 1: 91,084,799 (GRCm39) N674Y probably damaging Het
Ryr1 T C 7: 28,759,120 (GRCm39) I3353V possibly damaging Het
Sema3c C T 5: 17,929,130 (GRCm39) T588I possibly damaging Het
Sh2d5 A T 4: 137,986,393 (GRCm39) E372V possibly damaging Het
Slc27a6 C T 18: 58,705,130 (GRCm39) P171S probably benign Het
Slfn3 C T 11: 83,105,740 (GRCm39) T579I probably benign Het
Svil T G 18: 5,049,323 (GRCm39) V287G probably benign Het
Tas1r2 T A 4: 139,396,467 (GRCm39) V602D probably damaging Het
Tln2 A G 9: 67,179,971 (GRCm39) L800P probably damaging Het
Trim31 C A 17: 37,218,683 (GRCm39) Q323K possibly damaging Het
Txndc9 T A 1: 38,029,299 (GRCm39) D183V possibly damaging Het
Vmn2r28 T A 7: 5,491,474 (GRCm39) M258L probably benign Het
Vmn2r75 A T 7: 85,820,784 (GRCm39) I50N probably damaging Het
Zgrf1 A T 3: 127,381,683 (GRCm39) N1161Y possibly damaging Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128,377,266 (GRCm39) missense probably benign 0.03
IGL01098:Csmd2 APN 4 127,952,845 (GRCm39) missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128,262,923 (GRCm39) missense probably benign 0.04
IGL01364:Csmd2 APN 4 128,308,081 (GRCm39) missense probably benign 0.01
IGL01530:Csmd2 APN 4 128,308,094 (GRCm39) missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128,457,098 (GRCm39) nonsense probably null
IGL01670:Csmd2 APN 4 128,407,164 (GRCm39) splice site probably benign
IGL01707:Csmd2 APN 4 128,276,798 (GRCm39) missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128,374,638 (GRCm39) splice site probably benign
IGL01837:Csmd2 APN 4 128,313,363 (GRCm39) missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128,453,740 (GRCm39) missense unknown
IGL02013:Csmd2 APN 4 128,215,116 (GRCm39) missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128,453,672 (GRCm39) missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128,371,263 (GRCm39) splice site probably benign
IGL02303:Csmd2 APN 4 128,262,801 (GRCm39) missense probably benign 0.01
IGL02317:Csmd2 APN 4 128,357,520 (GRCm39) splice site probably benign
IGL02322:Csmd2 APN 4 128,357,520 (GRCm39) splice site probably benign
IGL02338:Csmd2 APN 4 128,288,859 (GRCm39) missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128,407,165 (GRCm39) splice site probably benign
IGL02428:Csmd2 APN 4 128,368,609 (GRCm39) missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128,428,050 (GRCm39) missense probably benign
IGL02701:Csmd2 APN 4 128,389,934 (GRCm39) missense probably benign 0.17
IGL02801:Csmd2 APN 4 128,445,868 (GRCm39) splice site probably null
IGL02818:Csmd2 APN 4 128,103,521 (GRCm39) missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128,415,677 (GRCm39) missense probably benign 0.00
IGL02876:Csmd2 APN 4 128,215,128 (GRCm39) nonsense probably null
IGL02977:Csmd2 APN 4 128,387,069 (GRCm39) nonsense probably null
IGL03006:Csmd2 APN 4 128,374,558 (GRCm39) splice site probably benign
IGL03032:Csmd2 APN 4 128,412,834 (GRCm39) missense probably benign 0.03
IGL03148:Csmd2 APN 4 128,278,062 (GRCm39) missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128,308,092 (GRCm39) nonsense probably null
IGL03245:Csmd2 APN 4 128,402,915 (GRCm39) missense probably benign 0.12
IGL03376:Csmd2 APN 4 128,411,464 (GRCm39) missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128,190,222 (GRCm39) missense probably benign 0.01
R0109:Csmd2 UTSW 4 128,438,536 (GRCm39) missense probably benign 0.03
R0112:Csmd2 UTSW 4 128,389,822 (GRCm39) missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128,415,704 (GRCm39) missense probably benign 0.02
R0390:Csmd2 UTSW 4 128,027,466 (GRCm39) intron probably benign
R0441:Csmd2 UTSW 4 128,414,023 (GRCm39) missense probably benign 0.00
R0519:Csmd2 UTSW 4 128,380,798 (GRCm39) missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128,007,469 (GRCm39) missense probably benign 0.00
R0746:Csmd2 UTSW 4 128,308,090 (GRCm39) missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128,389,981 (GRCm39) missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128,415,807 (GRCm39) missense probably benign 0.00
R1476:Csmd2 UTSW 4 128,380,794 (GRCm39) missense probably benign 0.08
R1641:Csmd2 UTSW 4 128,377,188 (GRCm39) missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128,389,988 (GRCm39) missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128,308,185 (GRCm39) critical splice donor site probably null
R2870:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2870:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2871:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2871:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2872:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2872:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2873:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2893:Csmd2 UTSW 4 128,432,786 (GRCm39) splice site probably null
R3796:Csmd2 UTSW 4 128,411,388 (GRCm39) missense probably benign 0.20
R3797:Csmd2 UTSW 4 128,411,388 (GRCm39) missense probably benign 0.20
R3798:Csmd2 UTSW 4 128,411,388 (GRCm39) missense probably benign 0.20
R3914:Csmd2 UTSW 4 128,215,117 (GRCm39) missense probably benign 0.07
R4198:Csmd2 UTSW 4 128,404,717 (GRCm39) missense probably benign 0.07
R4489:Csmd2 UTSW 4 128,275,738 (GRCm39) missense possibly damaging 0.68
R4571:Csmd2 UTSW 4 128,373,888 (GRCm39) splice site probably null
R4581:Csmd2 UTSW 4 128,262,881 (GRCm39) missense probably benign 0.02
R4599:Csmd2 UTSW 4 127,881,921 (GRCm39) missense probably benign 0.35
R4649:Csmd2 UTSW 4 128,439,866 (GRCm39) missense probably benign
R4706:Csmd2 UTSW 4 128,438,544 (GRCm39) missense probably benign
R4776:Csmd2 UTSW 4 128,336,685 (GRCm39) missense probably benign 0.09
R4838:Csmd2 UTSW 4 128,411,542 (GRCm39) missense probably benign
R4900:Csmd2 UTSW 4 128,346,318 (GRCm39) missense probably benign 0.03
R4999:Csmd2 UTSW 4 128,415,723 (GRCm39) missense probably benign 0.00
R5024:Csmd2 UTSW 4 128,215,141 (GRCm39) missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 127,952,901 (GRCm39) missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128,445,828 (GRCm39) missense probably benign 0.27
R5172:Csmd2 UTSW 4 128,371,190 (GRCm39) missense probably benign 0.10
R5231:Csmd2 UTSW 4 128,439,842 (GRCm39) missense probably benign 0.00
R5279:Csmd2 UTSW 4 128,350,707 (GRCm39) missense probably benign 0.30
R5287:Csmd2 UTSW 4 128,380,677 (GRCm39) missense probably benign 0.01
R5403:Csmd2 UTSW 4 128,380,677 (GRCm39) missense probably benign 0.01
R5410:Csmd2 UTSW 4 128,442,612 (GRCm39) missense probably benign
R5551:Csmd2 UTSW 4 128,404,741 (GRCm39) missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128,356,682 (GRCm39) critical splice donor site probably null
R5826:Csmd2 UTSW 4 128,412,992 (GRCm39) splice site probably null
R5907:Csmd2 UTSW 4 128,091,178 (GRCm39) missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128,445,781 (GRCm39) missense probably benign 0.01
R5970:Csmd2 UTSW 4 128,439,944 (GRCm39) missense probably benign 0.00
R5977:Csmd2 UTSW 4 127,952,827 (GRCm39) missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128,453,739 (GRCm39) missense unknown
R6075:Csmd2 UTSW 4 128,380,658 (GRCm39) missense probably benign 0.15
R6129:Csmd2 UTSW 4 128,387,127 (GRCm39) missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128,294,172 (GRCm39) missense probably benign 0.00
R6366:Csmd2 UTSW 4 128,377,245 (GRCm39) missense probably benign 0.00
R6404:Csmd2 UTSW 4 128,415,743 (GRCm39) missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127,881,893 (GRCm39) missense probably benign 0.24
R6643:Csmd2 UTSW 4 128,266,390 (GRCm39) missense probably benign 0.14
R6724:Csmd2 UTSW 4 128,457,164 (GRCm39) missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128,357,606 (GRCm39) missense probably benign 0.00
R6750:Csmd2 UTSW 4 128,091,018 (GRCm39) missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128,277,743 (GRCm39) missense probably benign 0.11
R6842:Csmd2 UTSW 4 128,402,952 (GRCm39) missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128,357,587 (GRCm39) missense probably benign 0.27
R6868:Csmd2 UTSW 4 128,336,633 (GRCm39) missense probably benign
R6882:Csmd2 UTSW 4 128,343,062 (GRCm39) missense probably benign 0.01
R7019:Csmd2 UTSW 4 128,262,856 (GRCm39) missense
R7028:Csmd2 UTSW 4 128,171,021 (GRCm39) missense
R7096:Csmd2 UTSW 4 128,356,519 (GRCm39) missense
R7122:Csmd2 UTSW 4 128,343,020 (GRCm39) missense
R7125:Csmd2 UTSW 4 128,389,955 (GRCm39) missense
R7197:Csmd2 UTSW 4 128,404,826 (GRCm39) missense
R7234:Csmd2 UTSW 4 128,350,572 (GRCm39) missense
R7299:Csmd2 UTSW 4 128,422,055 (GRCm39) missense
R7301:Csmd2 UTSW 4 128,422,055 (GRCm39) missense
R7319:Csmd2 UTSW 4 128,287,472 (GRCm39) missense
R7331:Csmd2 UTSW 4 128,458,021 (GRCm39) splice site probably null
R7332:Csmd2 UTSW 4 128,313,360 (GRCm39) missense
R7352:Csmd2 UTSW 4 128,451,429 (GRCm39) missense
R7402:Csmd2 UTSW 4 128,215,889 (GRCm39) missense
R7402:Csmd2 UTSW 4 128,215,888 (GRCm39) missense
R7474:Csmd2 UTSW 4 128,439,920 (GRCm39) missense
R7555:Csmd2 UTSW 4 128,346,251 (GRCm39) missense
R7592:Csmd2 UTSW 4 128,357,591 (GRCm39) missense
R7700:Csmd2 UTSW 4 128,439,549 (GRCm39) splice site probably null
R7714:Csmd2 UTSW 4 128,276,743 (GRCm39) nonsense probably null
R7734:Csmd2 UTSW 4 128,445,850 (GRCm39) missense
R7735:Csmd2 UTSW 4 128,350,723 (GRCm39) critical splice donor site probably null
R7757:Csmd2 UTSW 4 128,377,249 (GRCm39) missense
R7805:Csmd2 UTSW 4 128,313,366 (GRCm39) missense
R7823:Csmd2 UTSW 4 128,103,698 (GRCm39) missense
R7904:Csmd2 UTSW 4 128,313,346 (GRCm39) missense
R7946:Csmd2 UTSW 4 128,414,058 (GRCm39) missense
R7964:Csmd2 UTSW 4 128,417,303 (GRCm39) missense
R7968:Csmd2 UTSW 4 128,091,118 (GRCm39) missense
R8003:Csmd2 UTSW 4 128,432,980 (GRCm39) nonsense probably null
R8071:Csmd2 UTSW 4 128,287,331 (GRCm39) missense
R8504:Csmd2 UTSW 4 128,440,483 (GRCm39) missense
R8511:Csmd2 UTSW 4 128,262,692 (GRCm39) missense
R8517:Csmd2 UTSW 4 128,446,479 (GRCm39) missense
R8704:Csmd2 UTSW 4 128,091,147 (GRCm39) missense
R8722:Csmd2 UTSW 4 128,445,743 (GRCm39) unclassified probably benign
R8729:Csmd2 UTSW 4 128,356,638 (GRCm39) missense
R8801:Csmd2 UTSW 4 128,457,195 (GRCm39) missense probably damaging 0.97
R8803:Csmd2 UTSW 4 128,440,477 (GRCm39) missense
R8839:Csmd2 UTSW 4 128,336,681 (GRCm39) missense
R8867:Csmd2 UTSW 4 128,451,469 (GRCm39) missense
R8913:Csmd2 UTSW 4 128,417,351 (GRCm39) missense
R8928:Csmd2 UTSW 4 128,369,582 (GRCm39) missense
R8974:Csmd2 UTSW 4 128,446,380 (GRCm39) missense
R9001:Csmd2 UTSW 4 128,308,079 (GRCm39) missense
R9132:Csmd2 UTSW 4 128,443,007 (GRCm39) missense
R9245:Csmd2 UTSW 4 128,200,168 (GRCm39) missense
R9249:Csmd2 UTSW 4 128,313,323 (GRCm39) nonsense probably null
R9254:Csmd2 UTSW 4 128,091,112 (GRCm39) missense
R9265:Csmd2 UTSW 4 128,294,163 (GRCm39) missense
R9407:Csmd2 UTSW 4 128,442,613 (GRCm39) missense
R9432:Csmd2 UTSW 4 128,171,004 (GRCm39) missense
R9559:Csmd2 UTSW 4 128,438,561 (GRCm39) missense
R9673:Csmd2 UTSW 4 128,308,062 (GRCm39) missense
R9735:Csmd2 UTSW 4 128,402,901 (GRCm39) missense
R9749:Csmd2 UTSW 4 128,389,921 (GRCm39) missense
R9803:Csmd2 UTSW 4 128,262,986 (GRCm39) missense
Z1177:Csmd2 UTSW 4 128,424,590 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- AGCTAGCACGCTGTAGTCTC -3'
(R):5'- ACTGTATGGATCCTCAACCCAG -3'

Sequencing Primer
(F):5'- TCTGCAGAGTATGACCTG -3'
(R):5'- GCTCTAAGTTTGGCCCGC -3'
Posted On 2018-05-24