Incidental Mutation 'R6441:Sh2d5'
ID519008
Institutional Source Beutler Lab
Gene Symbol Sh2d5
Ensembl Gene ENSMUSG00000045349
Gene NameSH2 domain containing 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6441 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location138250403-138261332 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 138259082 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 372 (E372V)
Ref Sequence ENSEMBL: ENSMUSP00000101450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030539] [ENSMUST00000105818] [ENSMUST00000105821] [ENSMUST00000105823] [ENSMUST00000105824] [ENSMUST00000124239]
Predicted Effect probably benign
Transcript: ENSMUST00000030539
SMART Domains Protein: ENSMUSP00000030539
Gene: ENSMUSG00000028758

DomainStartEndE-ValueType
KISc 3 343 4.57e-178 SMART
coiled coil region 400 470 N/A INTRINSIC
low complexity region 723 736 N/A INTRINSIC
coiled coil region 806 852 N/A INTRINSIC
low complexity region 983 1000 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105818
SMART Domains Protein: ENSMUSP00000101444
Gene: ENSMUSG00000028758

DomainStartEndE-ValueType
KISc 1 151 1.46e-13 SMART
coiled coil region 208 278 N/A INTRINSIC
low complexity region 532 545 N/A INTRINSIC
coiled coil region 615 661 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105820
Predicted Effect probably benign
Transcript: ENSMUST00000105821
SMART Domains Protein: ENSMUSP00000101447
Gene: ENSMUSG00000028758

DomainStartEndE-ValueType
KISc 3 343 4.57e-178 SMART
low complexity region 486 499 N/A INTRINSIC
coiled coil region 569 615 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105823
AA Change: E372V

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101449
Gene: ENSMUSG00000045349
AA Change: E372V

DomainStartEndE-ValueType
Pfam:PID 27 149 1e-6 PFAM
SH2 300 384 9.29e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105824
AA Change: E372V

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101450
Gene: ENSMUSG00000045349
AA Change: E372V

DomainStartEndE-ValueType
SCOP:d1ddma_ 24 146 8e-18 SMART
Blast:PTB 28 146 6e-6 BLAST
SH2 300 384 9.29e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124239
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154421
Meta Mutation Damage Score 0.1200 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl A T 3: 116,771,459 M1047K probably benign Het
Apob A T 12: 7,987,796 D322V probably damaging Het
Capn12 T A 7: 28,888,002 C438S probably benign Het
Cdh23 A T 10: 60,308,036 V2932E probably damaging Het
Cdh9 A T 15: 16,823,423 T164S probably benign Het
CN725425 T C 15: 91,235,802 V42A probably benign Het
Cpb1 T C 3: 20,249,814 D362G probably damaging Het
Csmd2 C A 4: 128,394,964 Q1099K probably benign Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Galnt4 A G 10: 99,110,098 M562V possibly damaging Het
Gtf3c3 T A 1: 54,406,038 E619V probably benign Het
Gucy2c A T 6: 136,723,761 M585K probably damaging Het
Hmcn1 A G 1: 150,703,216 I1993T possibly damaging Het
Lonrf2 T C 1: 38,818,123 E44G possibly damaging Het
Lrit3 A T 3: 129,800,360 F189L probably benign Het
Mag T C 7: 30,907,083 N310D possibly damaging Het
Mccc2 T C 13: 99,954,676 T151A probably damaging Het
Mybpc1 A T 10: 88,553,277 S49T probably benign Het
Myh2 A G 11: 67,194,611 E1787G probably benign Het
Ncapd3 A G 9: 27,063,416 D728G probably benign Het
Nup37 A G 10: 88,160,937 E139G probably benign Het
Odf3 T C 7: 140,849,248 S149P probably damaging Het
Olfr651 C T 7: 104,553,335 Q139* probably null Het
Pcdhgb5 A G 18: 37,732,085 Y311C probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Rbm44 A T 1: 91,157,077 N674Y probably damaging Het
Ryr1 T C 7: 29,059,695 I3353V possibly damaging Het
Sema3c C T 5: 17,724,132 T588I possibly damaging Het
Slc27a6 C T 18: 58,572,058 P171S probably benign Het
Slfn3 C T 11: 83,214,914 T579I probably benign Het
Svil T G 18: 5,049,323 V287G probably benign Het
Tas1r2 T A 4: 139,669,156 V602D probably damaging Het
Tln2 A G 9: 67,272,689 L800P probably damaging Het
Trim31 C A 17: 36,907,791 Q323K possibly damaging Het
Txndc9 T A 1: 37,990,218 D183V possibly damaging Het
Vmn2r28 T A 7: 5,488,475 M258L probably benign Het
Vmn2r75 A T 7: 86,171,576 I50N probably damaging Het
Zgrf1 A T 3: 127,588,034 N1161Y possibly damaging Het
Other mutations in Sh2d5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02150:Sh2d5 APN 4 138258242 missense probably benign 0.19
IGL02715:Sh2d5 APN 4 138256707 splice site probably benign
R0621:Sh2d5 UTSW 4 138258318 missense probably benign 0.12
R0622:Sh2d5 UTSW 4 138259228 missense probably damaging 0.97
R4605:Sh2d5 UTSW 4 138257255 nonsense probably null
R4828:Sh2d5 UTSW 4 138258255 missense probably damaging 1.00
R5372:Sh2d5 UTSW 4 138254699 missense possibly damaging 0.95
R6053:Sh2d5 UTSW 4 138255562 missense probably damaging 0.96
R7336:Sh2d5 UTSW 4 138256839 missense probably benign
R7621:Sh2d5 UTSW 4 138256839 missense probably benign 0.01
R7642:Sh2d5 UTSW 4 138259156 missense probably benign 0.05
R7828:Sh2d5 UTSW 4 138256797 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TTAGAGGTTATCTCGAGGAGAGC -3'
(R):5'- TAGCCCAGGCCTTGCAATTC -3'

Sequencing Primer
(F):5'- TTATCTCGAGGAGAGCTGGCC -3'
(R):5'- GCAATTCCGCCTCAGACTTGG -3'
Posted On2018-05-24