Mutagenetix > Incidental Mutation

Incidental Mutation 'R6441:Gucy2c'

519012

Institutional Source

Beutler Lab

Gene Symbol

Gucy2c

Ensembl Gene

ENSMUSG00000042638

Gene Name

guanylate cyclase 2c

Synonyms

GC-C

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6441 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

136697284-136781765 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 136723761 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 585 (M585K)

Ref Sequence

ENSEMBL: ENSMUSP00000032338 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032338] [ENSMUST00000078095]

AlphaFold

Q3UWA6

Predicted Effect

probably damaging
Transcript: ENSMUST00000032338
AA Change: M585K

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000032338
Gene: ENSMUSG00000042638
AA Change: M585K

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	113	384	3.7e-8	PFAM
transmembrane domain	432	454	N/A	INTRINSIC
Pfam:Pkinase_Tyr	498	744	3.4e-33	PFAM
Pfam:Pkinase	499	744	1e-26	PFAM
CYCc	787	982	2.68e-107	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000078095
AA Change: M561K

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000077236
Gene: ENSMUSG00000042638
AA Change: M561K

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	53	385	2.7e-41	PFAM
transmembrane domain	432	454	N/A	INTRINSIC
Pfam:Pkinase_Tyr	475	720	6.5e-32	PFAM
Pfam:Pkinase	480	720	7.2e-25	PFAM
CYCc	763	958	2.68e-107	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that functions as a receptor for endogenous peptides guanylin and uroguanylin, and the heat-stable E. coli enterotoxin. The encoded protein activates the cystic fibrosis transmembrane conductance regulator. Mutations in this gene are associated with familial diarrhea (autosomal dominant) and meconium ileus (autosomal recessive). [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous null mice are viable and have an increased resistance to heat-stable enterotoxins. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agl	A	T	3: 116,771,459	M1047K	probably benign	Het
Apob	A	T	12: 7,987,796	D322V	probably damaging	Het
Capn12	T	A	7: 28,888,002	C438S	probably benign	Het
Cdh23	A	T	10: 60,308,036	V2932E	probably damaging	Het
Cdh9	A	T	15: 16,823,423	T164S	probably benign	Het
CN725425	T	C	15: 91,235,802	V42A	probably benign	Het
Cpb1	T	C	3: 20,249,814	D362G	probably damaging	Het
Csmd2	C	A	4: 128,394,964	Q1099K	probably benign	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Galnt4	A	G	10: 99,110,098	M562V	possibly damaging	Het
Gtf3c3	T	A	1: 54,406,038	E619V	probably benign	Het
Hmcn1	A	G	1: 150,703,216	I1993T	possibly damaging	Het
Lonrf2	T	C	1: 38,818,123	E44G	possibly damaging	Het
Lrit3	A	T	3: 129,800,360	F189L	probably benign	Het
Mag	T	C	7: 30,907,083	N310D	possibly damaging	Het
Mccc2	T	C	13: 99,954,676	T151A	probably damaging	Het
Mybpc1	A	T	10: 88,553,277	S49T	probably benign	Het
Myh2	A	G	11: 67,194,611	E1787G	probably benign	Het
Ncapd3	A	G	9: 27,063,416	D728G	probably benign	Het
Nup37	A	G	10: 88,160,937	E139G	probably benign	Het
Odf3	T	C	7: 140,849,248	S149P	probably damaging	Het
Olfr651	C	T	7: 104,553,335	Q139*	probably null	Het
Pcdhgb5	A	G	18: 37,732,085	Y311C	probably damaging	Het
Pls1	A	G	9: 95,754,745	I558T	probably damaging	Het
Rbm44	A	T	1: 91,157,077	N674Y	probably damaging	Het
Ryr1	T	C	7: 29,059,695	I3353V	possibly damaging	Het
Sema3c	C	T	5: 17,724,132	T588I	possibly damaging	Het
Sh2d5	A	T	4: 138,259,082	E372V	possibly damaging	Het
Slc27a6	C	T	18: 58,572,058	P171S	probably benign	Het
Slfn3	C	T	11: 83,214,914	T579I	probably benign	Het
Svil	T	G	18: 5,049,323	V287G	probably benign	Het
Tas1r2	T	A	4: 139,669,156	V602D	probably damaging	Het
Tln2	A	G	9: 67,272,689	L800P	probably damaging	Het
Trim31	C	A	17: 36,907,791	Q323K	possibly damaging	Het
Txndc9	T	A	1: 37,990,218	D183V	possibly damaging	Het
Vmn2r28	T	A	7: 5,488,475	M258L	probably benign	Het
Vmn2r75	A	T	7: 86,171,576	I50N	probably damaging	Het
Zgrf1	A	T	3: 127,588,034	N1161Y	possibly damaging	Het

Other mutations in Gucy2c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00849:Gucy2c	APN	6	136765614	missense	probably benign	0.01
IGL01081:Gucy2c	APN	6	136702739	missense	probably damaging	1.00
IGL01285:Gucy2c	APN	6	136709741	missense	probably damaging	1.00
IGL01395:Gucy2c	APN	6	136698029	missense	probably damaging	1.00
IGL01408:Gucy2c	APN	6	136698011	missense	probably benign	0.19
IGL01752:Gucy2c	APN	6	136770108	missense	probably benign	0.10
IGL01766:Gucy2c	APN	6	136715973	missense	probably benign	0.43
IGL02245:Gucy2c	APN	6	136729203	missense	probably benign	0.00
IGL02648:Gucy2c	APN	6	136729213	nonsense	probably null
IGL02794:Gucy2c	APN	6	136713148	missense	probably damaging	1.00
IGL03023:Gucy2c	APN	6	136702796	splice site	probably null
IGL03178:Gucy2c	APN	6	136729239	splice site	probably benign
IGL03310:Gucy2c	APN	6	136751046	missense	probably benign
IGL03374:Gucy2c	APN	6	136765630	missense	probably benign	0.00
IGL03393:Gucy2c	APN	6	136719667	missense	probably benign	0.04
BB001:Gucy2c	UTSW	6	136763055	missense	probably benign	0.35
BB011:Gucy2c	UTSW	6	136763055	missense	probably benign	0.35
R0031:Gucy2c	UTSW	6	136697999	missense	probably damaging	0.99
R0128:Gucy2c	UTSW	6	136704249	missense	probably damaging	1.00
R0377:Gucy2c	UTSW	6	136750917	critical splice donor site	probably null
R0593:Gucy2c	UTSW	6	136728335	missense	probably damaging	0.99
R0613:Gucy2c	UTSW	6	136760723	missense	probably damaging	1.00
R0723:Gucy2c	UTSW	6	136727801	splice site	probably null
R0828:Gucy2c	UTSW	6	136709748	missense	probably damaging	1.00
R0837:Gucy2c	UTSW	6	136722420	missense	probably damaging	0.99
R0880:Gucy2c	UTSW	6	136709832	critical splice acceptor site	probably null
R1350:Gucy2c	UTSW	6	136743914	critical splice donor site	probably null
R1487:Gucy2c	UTSW	6	136748826	missense	possibly damaging	0.79
R1680:Gucy2c	UTSW	6	136722493	missense	probably damaging	1.00
R1751:Gucy2c	UTSW	6	136748775	splice site	probably benign
R1791:Gucy2c	UTSW	6	136744027	missense	probably damaging	1.00
R1953:Gucy2c	UTSW	6	136704293	missense	probably damaging	1.00
R2135:Gucy2c	UTSW	6	136723728	missense	probably damaging	1.00
R2227:Gucy2c	UTSW	6	136702760	missense	probably damaging	1.00
R2350:Gucy2c	UTSW	6	136763074	missense	probably damaging	0.98
R2906:Gucy2c	UTSW	6	136708387	missense	probably damaging	1.00
R2907:Gucy2c	UTSW	6	136708387	missense	probably damaging	1.00
R3699:Gucy2c	UTSW	6	136770111	missense	probably damaging	1.00
R3972:Gucy2c	UTSW	6	136708366	missense	probably damaging	1.00
R4613:Gucy2c	UTSW	6	136708321	missense	probably damaging	1.00
R4732:Gucy2c	UTSW	6	136767152	missense	probably damaging	1.00
R4733:Gucy2c	UTSW	6	136767152	missense	probably damaging	1.00
R4776:Gucy2c	UTSW	6	136722514	missense	probably damaging	1.00
R5087:Gucy2c	UTSW	6	136767035	missense	possibly damaging	0.69
R5284:Gucy2c	UTSW	6	136763043	missense	possibly damaging	0.56
R5366:Gucy2c	UTSW	6	136720741	missense	probably damaging	0.99
R5466:Gucy2c	UTSW	6	136781465	nonsense	probably null
R5911:Gucy2c	UTSW	6	136722442	missense	probably damaging	1.00
R6160:Gucy2c	UTSW	6	136740686	nonsense	probably null
R6367:Gucy2c	UTSW	6	136709778	missense	probably damaging	1.00
R6812:Gucy2c	UTSW	6	136697995	missense	probably benign
R6865:Gucy2c	UTSW	6	136770129	missense	probably benign	0.13
R7065:Gucy2c	UTSW	6	136720766	missense	probably damaging	1.00
R7078:Gucy2c	UTSW	6	136697939	missense	probably benign	0.19
R7096:Gucy2c	UTSW	6	136728341	missense	probably benign	0.11
R7138:Gucy2c	UTSW	6	136728344	missense	probably damaging	1.00
R7343:Gucy2c	UTSW	6	136702748	missense	probably damaging	1.00
R7538:Gucy2c	UTSW	6	136709744	missense	probably damaging	1.00
R7587:Gucy2c	UTSW	6	136704290	missense	probably damaging	1.00
R7666:Gucy2c	UTSW	6	136697968	missense	probably benign
R7675:Gucy2c	UTSW	6	136716032	missense	possibly damaging	0.91
R7822:Gucy2c	UTSW	6	136708406	missense	probably damaging	1.00
R7842:Gucy2c	UTSW	6	136769816	splice site	probably null
R7924:Gucy2c	UTSW	6	136763055	missense	probably benign	0.35
R8078:Gucy2c	UTSW	6	136697921	missense	probably damaging	1.00
R8094:Gucy2c	UTSW	6	136737448	missense	probably benign	0.33
R8391:Gucy2c	UTSW	6	136704215	missense	probably damaging	1.00
R8428:Gucy2c	UTSW	6	136727894	missense	probably damaging	0.96
R9188:Gucy2c	UTSW	6	136723758	missense	probably benign	0.44
R9189:Gucy2c	UTSW	6	136751047	missense	probably benign
R9325:Gucy2c	UTSW	6	136766994	nonsense	probably null
R9361:Gucy2c	UTSW	6	136737431	missense	possibly damaging	0.80
R9413:Gucy2c	UTSW	6	136723773	missense	possibly damaging	0.94
Z1088:Gucy2c	UTSW	6	136743981	missense	probably benign
Z1177:Gucy2c	UTSW	6	136719687	missense	probably damaging	1.00
Z1177:Gucy2c	UTSW	6	136767196	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ATTATGTCATCAAGTCCTGCCCAC -3'
(R):5'- CTACCACACTGCTCAGATGG -3'

Sequencing Primer
(F):5'- GTCCTGCCCACGACACATC -3'
(R):5'- ACACTGCTCAGATGGTAGCTGTC -3'

Posted On

2018-05-24