Mutagenetix > Incidental Mutation

Incidental Mutation 'R6441:Vmn2r75'

519017

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r75

Ensembl Gene

ENSMUSG00000090436

Gene Name

vomeronasal 2, receptor 75

Synonyms

EG546981

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

R6441 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

86148042-86171724 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 86171576 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 50 (I50N)

Ref Sequence

ENSEMBL: ENSMUSP00000126973 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167830]

AlphaFold

G5E8Z7

Predicted Effect

probably damaging
Transcript: ENSMUST00000167830
AA Change: I50N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000126973
Gene: ENSMUSG00000090436
AA Change: I50N

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	80	466	2.8e-31	PFAM
Pfam:NCD3G	510	562	4.6e-20	PFAM
Pfam:7tm_3	593	829	7.7e-51	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agl	A	T	3: 116,771,459	M1047K	probably benign	Het
Apob	A	T	12: 7,987,796	D322V	probably damaging	Het
Capn12	T	A	7: 28,888,002	C438S	probably benign	Het
Cdh23	A	T	10: 60,308,036	V2932E	probably damaging	Het
Cdh9	A	T	15: 16,823,423	T164S	probably benign	Het
CN725425	T	C	15: 91,235,802	V42A	probably benign	Het
Cpb1	T	C	3: 20,249,814	D362G	probably damaging	Het
Csmd2	C	A	4: 128,394,964	Q1099K	probably benign	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Galnt4	A	G	10: 99,110,098	M562V	possibly damaging	Het
Gtf3c3	T	A	1: 54,406,038	E619V	probably benign	Het
Gucy2c	A	T	6: 136,723,761	M585K	probably damaging	Het
Hmcn1	A	G	1: 150,703,216	I1993T	possibly damaging	Het
Lonrf2	T	C	1: 38,818,123	E44G	possibly damaging	Het
Lrit3	A	T	3: 129,800,360	F189L	probably benign	Het
Mag	T	C	7: 30,907,083	N310D	possibly damaging	Het
Mccc2	T	C	13: 99,954,676	T151A	probably damaging	Het
Mybpc1	A	T	10: 88,553,277	S49T	probably benign	Het
Myh2	A	G	11: 67,194,611	E1787G	probably benign	Het
Ncapd3	A	G	9: 27,063,416	D728G	probably benign	Het
Nup37	A	G	10: 88,160,937	E139G	probably benign	Het
Odf3	T	C	7: 140,849,248	S149P	probably damaging	Het
Olfr651	C	T	7: 104,553,335	Q139*	probably null	Het
Pcdhgb5	A	G	18: 37,732,085	Y311C	probably damaging	Het
Pls1	A	G	9: 95,754,745	I558T	probably damaging	Het
Rbm44	A	T	1: 91,157,077	N674Y	probably damaging	Het
Ryr1	T	C	7: 29,059,695	I3353V	possibly damaging	Het
Sema3c	C	T	5: 17,724,132	T588I	possibly damaging	Het
Sh2d5	A	T	4: 138,259,082	E372V	possibly damaging	Het
Slc27a6	C	T	18: 58,572,058	P171S	probably benign	Het
Slfn3	C	T	11: 83,214,914	T579I	probably benign	Het
Svil	T	G	18: 5,049,323	V287G	probably benign	Het
Tas1r2	T	A	4: 139,669,156	V602D	probably damaging	Het
Tln2	A	G	9: 67,272,689	L800P	probably damaging	Het
Trim31	C	A	17: 36,907,791	Q323K	possibly damaging	Het
Txndc9	T	A	1: 37,990,218	D183V	possibly damaging	Het
Vmn2r28	T	A	7: 5,488,475	M258L	probably benign	Het
Zgrf1	A	T	3: 127,588,034	N1161Y	possibly damaging	Het

Other mutations in Vmn2r75

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01133:Vmn2r75	APN	7	86148032	unclassified	probably benign
IGL01287:Vmn2r75	APN	7	86148593	missense	probably damaging	0.97
IGL01318:Vmn2r75	APN	7	86165566	missense	probably benign	0.06
IGL01331:Vmn2r75	APN	7	86171662	nonsense	probably null
IGL01406:Vmn2r75	APN	7	86163292	splice site	probably benign
IGL01615:Vmn2r75	APN	7	86148473	missense	probably benign	0.03
IGL01657:Vmn2r75	APN	7	86164247	missense	probably damaging	1.00
IGL02237:Vmn2r75	APN	7	86165578	missense	possibly damaging	0.88
IGL02275:Vmn2r75	APN	7	86165140	missense	probably benign	0.04
IGL02307:Vmn2r75	APN	7	86165766	missense	probably benign	0.00
IGL03136:Vmn2r75	APN	7	86148703	missense	possibly damaging	0.89
IGL03160:Vmn2r75	APN	7	86148436	missense	probably damaging	1.00
IGL03244:Vmn2r75	APN	7	86171725	unclassified	probably benign
PIT4449001:Vmn2r75	UTSW	7	86165583	missense	probably damaging	1.00
R0049:Vmn2r75	UTSW	7	86148101	nonsense	probably null
R0049:Vmn2r75	UTSW	7	86148101	nonsense	probably null
R0083:Vmn2r75	UTSW	7	86165658	missense	probably benign	0.00
R0108:Vmn2r75	UTSW	7	86165658	missense	probably benign	0.00
R0276:Vmn2r75	UTSW	7	86148307	missense	probably benign	0.01
R0320:Vmn2r75	UTSW	7	86165080	missense	probably benign	0.36
R0471:Vmn2r75	UTSW	7	86165513	missense	probably benign	0.01
R0562:Vmn2r75	UTSW	7	86148241	nonsense	probably null
R0631:Vmn2r75	UTSW	7	86163270	missense	probably null	1.00
R0661:Vmn2r75	UTSW	7	86165658	missense	probably benign	0.00
R0811:Vmn2r75	UTSW	7	86165367	missense	probably benign	0.38
R0812:Vmn2r75	UTSW	7	86165367	missense	probably benign	0.38
R0891:Vmn2r75	UTSW	7	86164268	missense	possibly damaging	0.81
R1340:Vmn2r75	UTSW	7	86148590	missense	probably damaging	0.98
R1501:Vmn2r75	UTSW	7	86165642	missense	possibly damaging	0.85
R1760:Vmn2r75	UTSW	7	86148811	missense	probably damaging	1.00
R1970:Vmn2r75	UTSW	7	86148262	missense	probably damaging	1.00
R2060:Vmn2r75	UTSW	7	86165164	missense	probably benign	0.00
R2292:Vmn2r75	UTSW	7	86148936	missense	probably damaging	1.00
R3688:Vmn2r75	UTSW	7	86148421	missense	probably damaging	0.99
R3892:Vmn2r75	UTSW	7	86164286	missense	probably null	1.00
R4532:Vmn2r75	UTSW	7	86148141	nonsense	probably null
R4583:Vmn2r75	UTSW	7	86164082	missense	possibly damaging	0.81
R4592:Vmn2r75	UTSW	7	86166286	missense	probably benign	0.00
R4792:Vmn2r75	UTSW	7	86163170	missense	possibly damaging	0.46
R4859:Vmn2r75	UTSW	7	86148403	missense	probably benign	0.35
R4896:Vmn2r75	UTSW	7	86171579	missense	probably benign	0.01
R4943:Vmn2r75	UTSW	7	86165497	missense	probably damaging	1.00
R4992:Vmn2r75	UTSW	7	86166167	critical splice donor site	probably null
R5048:Vmn2r75	UTSW	7	86165527	missense	possibly damaging	0.66
R5063:Vmn2r75	UTSW	7	86164164	missense	probably benign
R5156:Vmn2r75	UTSW	7	86164228	missense	possibly damaging	0.51
R5243:Vmn2r75	UTSW	7	86164239	missense	probably damaging	1.00
R5277:Vmn2r75	UTSW	7	86166292	missense	probably benign
R5574:Vmn2r75	UTSW	7	86166302	missense	probably benign	0.22
R5622:Vmn2r75	UTSW	7	86148494	missense	probably benign	0.15
R5680:Vmn2r75	UTSW	7	86171571	missense	probably benign	0.10
R5884:Vmn2r75	UTSW	7	86165370	missense	probably benign
R6021:Vmn2r75	UTSW	7	86171612	missense	probably benign	0.01
R6217:Vmn2r75	UTSW	7	86166167	critical splice donor site	probably benign
R6242:Vmn2r75	UTSW	7	86165384	missense	probably damaging	1.00
R6299:Vmn2r75	UTSW	7	86165274	missense	probably benign	0.12
R6495:Vmn2r75	UTSW	7	86164079	missense	probably benign	0.00
R6553:Vmn2r75	UTSW	7	86164245	missense	probably benign	0.28
R6670:Vmn2r75	UTSW	7	86148436	missense	probably damaging	1.00
R7078:Vmn2r75	UTSW	7	86166360	missense	probably damaging	1.00
R7164:Vmn2r75	UTSW	7	86165384	missense	probably damaging	1.00
R8411:Vmn2r75	UTSW	7	86148514	missense	probably damaging	1.00
R8507:Vmn2r75	UTSW	7	86148477	nonsense	probably null
R8559:Vmn2r75	UTSW	7	86166272	missense	possibly damaging	0.65
R8677:Vmn2r75	UTSW	7	86165202	missense	possibly damaging	0.86
R8708:Vmn2r75	UTSW	7	86163268	missense	probably damaging	0.99
R8778:Vmn2r75	UTSW	7	86164289	missense	probably benign	0.40
R8968:Vmn2r75	UTSW	7	86171557	nonsense	probably null
R9145:Vmn2r75	UTSW	7	86164239	missense	probably damaging	1.00
R9316:Vmn2r75	UTSW	7	86148105	missense	possibly damaging	0.63
R9363:Vmn2r75	UTSW	7	86166215	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- ATCTCCTAGAAAGAAATAGCCAGAG -3'
(R):5'- ATAAATAGTGGTGCCTGGATGG -3'

Sequencing Primer
(F):5'- CCAGAGGAGCACATGGTATC -3'
(R):5'- TGCCTGGATGGGTTCACAC -3'

Posted On

2018-05-24