Incidental Mutation 'R6441:Pls1'
ID519022
Institutional Source Beutler Lab
Gene Symbol Pls1
Ensembl Gene ENSMUSG00000049493
Gene Nameplastin 1 (I-isoform)
SynonymsI-fimbrin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R6441 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location95752642-95845311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95754745 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 558 (I558T)
Ref Sequence ENSEMBL: ENSMUSP00000091317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053785] [ENSMUST00000093800] [ENSMUST00000189137] [ENSMUST00000190497] [ENSMUST00000190604]
Predicted Effect probably benign
Transcript: ENSMUST00000053785
SMART Domains Protein: ENSMUSP00000057640
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
ANK 62 93 1.41e2 SMART
ANK 99 129 2.11e1 SMART
ANK 174 203 1.33e2 SMART
Pfam:TRP_2 209 271 2.6e-27 PFAM
transmembrane domain 367 386 N/A INTRINSIC
Pfam:Ion_trans 407 673 5.9e-17 PFAM
coiled coil region 770 794 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093800
AA Change: I558T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091317
Gene: ENSMUSG00000049493
AA Change: I558T

DomainStartEndE-ValueType
EFh 15 43 8.5e-5 SMART
EFh 55 83 1.73e-5 SMART
low complexity region 100 116 N/A INTRINSIC
CH 124 236 3.69e-23 SMART
CH 268 375 4.4e-21 SMART
CH 398 503 7.27e-22 SMART
CH 519 624 3.75e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189137
SMART Domains Protein: ENSMUSP00000139672
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
ANK 62 93 1.41e2 SMART
ANK 99 129 2.11e1 SMART
ANK 174 203 1.33e2 SMART
Pfam:TRP_2 209 271 1.8e-29 PFAM
transmembrane domain 367 386 N/A INTRINSIC
transmembrane domain 407 424 N/A INTRINSIC
Pfam:Ion_trans 441 661 1.2e-21 PFAM
coiled coil region 770 794 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190205
Predicted Effect probably benign
Transcript: ENSMUST00000190497
SMART Domains Protein: ENSMUSP00000140550
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190604
SMART Domains Protein: ENSMUSP00000139577
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Meta Mutation Damage Score 0.7913 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. The protein encoded by this gene is a third distinct plastin isoform, which is specifically expressed at high levels in the small intestine. Alternatively spliced transcript variants varying in the 5' UTR, but encoding the same protein, have been found for this gene. A pseudogene of this gene is found on chromosome 11.[provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous inactivation for this gene leads to altered intestinal morphology and physiology, increased brush border fragility and susceptibility to induced colitis, as well as a moderate and progressive form of hearing loss associated with defects in stereocilia morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl A T 3: 116,771,459 M1047K probably benign Het
Apob A T 12: 7,987,796 D322V probably damaging Het
Capn12 T A 7: 28,888,002 C438S probably benign Het
Cdh23 A T 10: 60,308,036 V2932E probably damaging Het
Cdh9 A T 15: 16,823,423 T164S probably benign Het
CN725425 T C 15: 91,235,802 V42A probably benign Het
Cpb1 T C 3: 20,249,814 D362G probably damaging Het
Csmd2 C A 4: 128,394,964 Q1099K probably benign Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Galnt4 A G 10: 99,110,098 M562V possibly damaging Het
Gtf3c3 T A 1: 54,406,038 E619V probably benign Het
Gucy2c A T 6: 136,723,761 M585K probably damaging Het
Hmcn1 A G 1: 150,703,216 I1993T possibly damaging Het
Lonrf2 T C 1: 38,818,123 E44G possibly damaging Het
Lrit3 A T 3: 129,800,360 F189L probably benign Het
Mag T C 7: 30,907,083 N310D possibly damaging Het
Mccc2 T C 13: 99,954,676 T151A probably damaging Het
Mybpc1 A T 10: 88,553,277 S49T probably benign Het
Myh2 A G 11: 67,194,611 E1787G probably benign Het
Ncapd3 A G 9: 27,063,416 D728G probably benign Het
Nup37 A G 10: 88,160,937 E139G probably benign Het
Odf3 T C 7: 140,849,248 S149P probably damaging Het
Olfr651 C T 7: 104,553,335 Q139* probably null Het
Pcdhgb5 A G 18: 37,732,085 Y311C probably damaging Het
Rbm44 A T 1: 91,157,077 N674Y probably damaging Het
Ryr1 T C 7: 29,059,695 I3353V possibly damaging Het
Sema3c C T 5: 17,724,132 T588I possibly damaging Het
Sh2d5 A T 4: 138,259,082 E372V possibly damaging Het
Slc27a6 C T 18: 58,572,058 P171S probably benign Het
Slfn3 C T 11: 83,214,914 T579I probably benign Het
Svil T G 18: 5,049,323 V287G probably benign Het
Tas1r2 T A 4: 139,669,156 V602D probably damaging Het
Tln2 A G 9: 67,272,689 L800P probably damaging Het
Trim31 C A 17: 36,907,791 Q323K possibly damaging Het
Txndc9 T A 1: 37,990,218 D183V possibly damaging Het
Vmn2r28 T A 7: 5,488,475 M258L probably benign Het
Vmn2r75 A T 7: 86,171,576 I50N probably damaging Het
Zgrf1 A T 3: 127,588,034 N1161Y possibly damaging Het
Other mutations in Pls1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Pls1 APN 9 95782419 missense possibly damaging 0.95
IGL00836:Pls1 APN 9 95761422 missense possibly damaging 0.86
IGL01391:Pls1 APN 9 95773698 missense probably benign 0.38
IGL02335:Pls1 APN 9 95784183 missense probably benign 0.32
IGL02875:Pls1 APN 9 95754351 missense possibly damaging 0.93
IGL03081:Pls1 APN 9 95773643 missense probably damaging 1.00
IGL03271:Pls1 APN 9 95776830 missense probably benign 0.04
PIT4585001:Pls1 UTSW 9 95761390 missense probably benign
R0048:Pls1 UTSW 9 95787063 missense probably damaging 1.00
R0088:Pls1 UTSW 9 95795768 missense possibly damaging 0.93
R0409:Pls1 UTSW 9 95786919 splice site probably benign
R2015:Pls1 UTSW 9 95761365 missense possibly damaging 0.77
R2516:Pls1 UTSW 9 95776563 missense probably benign 0.00
R2985:Pls1 UTSW 9 95785582 missense possibly damaging 0.73
R3964:Pls1 UTSW 9 95785612 missense probably benign 0.00
R3965:Pls1 UTSW 9 95785612 missense probably benign 0.00
R5240:Pls1 UTSW 9 95776622 splice site probably null
R5681:Pls1 UTSW 9 95787012 missense probably damaging 1.00
R6399:Pls1 UTSW 9 95754745 missense probably damaging 0.99
R6496:Pls1 UTSW 9 95754745 missense probably damaging 0.99
R6498:Pls1 UTSW 9 95754745 missense probably damaging 0.99
R6499:Pls1 UTSW 9 95754745 missense probably damaging 0.99
R7016:Pls1 UTSW 9 95786941 missense probably damaging 1.00
R7177:Pls1 UTSW 9 95773559 missense probably benign 0.01
R7458:Pls1 UTSW 9 95785507 missense probably damaging 1.00
R7467:Pls1 UTSW 9 95769113 missense possibly damaging 0.78
R7536:Pls1 UTSW 9 95762057 missense probably damaging 1.00
R7553:Pls1 UTSW 9 95787087 missense probably damaging 1.00
R7691:Pls1 UTSW 9 95773673 missense probably benign 0.21
R7756:Pls1 UTSW 9 95776844 missense probably benign 0.44
R7758:Pls1 UTSW 9 95776844 missense probably benign 0.44
R7876:Pls1 UTSW 9 95785505 nonsense probably null
R8269:Pls1 UTSW 9 95761970 missense probably damaging 1.00
R8380:Pls1 UTSW 9 95775385 missense probably benign 0.03
Z1177:Pls1 UTSW 9 95754387 missense probably damaging 0.99
Z1177:Pls1 UTSW 9 95785618 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GAAAAGGAAGACATCTTAGCATCTG -3'
(R):5'- GTGTTGGTTGCAGAAAAGCTTAC -3'

Sequencing Primer
(F):5'- GGAAGACATCTTAGCATCTGTTATC -3'
(R):5'- TGGTTGCAGAAAAGCTTACTATTAAG -3'
Posted On2018-05-24