Incidental Mutation 'R6441:Nup37'
ID519024
Institutional Source Beutler Lab
Gene Symbol Nup37
Ensembl Gene ENSMUSG00000035351
Gene Namenucleoporin 37
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6441 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location88146992-88178390 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88160937 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 139 (E139G)
Ref Sequence ENSEMBL: ENSMUSP00000129728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052355] [ENSMUST00000169309]
Predicted Effect probably benign
Transcript: ENSMUST00000052355
AA Change: E139G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000059880
Gene: ENSMUSG00000035351
AA Change: E139G

DomainStartEndE-ValueType
WD40 62 108 6.16e0 SMART
WD40 113 153 2.29e-8 SMART
WD40 155 194 2.97e0 SMART
Blast:WD40 198 236 4e-14 BLAST
Blast:WD40 287 323 8e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158218
Predicted Effect probably benign
Transcript: ENSMUST00000169309
AA Change: E139G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129728
Gene: ENSMUSG00000035351
AA Change: E139G

DomainStartEndE-ValueType
WD40 62 108 6.16e0 SMART
WD40 113 153 2.29e-8 SMART
WD40 155 194 2.97e0 SMART
Blast:WD40 198 236 4e-14 BLAST
Blast:WD40 287 323 8e-16 BLAST
Meta Mutation Damage Score 0.0747 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nuclear pore complexes (NPCs) are used for transporting macromolecules between the cytoplasm and the nucleus. NPCs consist of multiple copies of 30 distinct proteins (nucleoporins), which assemble into biochemically-separable subcomplexes. The protein encoded by this gene is part of a subcomplex (Nup107-160) that is required for proper NPC function as well as for normal kinetochore-microtubule interaction and mitosis. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl A T 3: 116,771,459 M1047K probably benign Het
Apob A T 12: 7,987,796 D322V probably damaging Het
Capn12 T A 7: 28,888,002 C438S probably benign Het
Cdh23 A T 10: 60,308,036 V2932E probably damaging Het
Cdh9 A T 15: 16,823,423 T164S probably benign Het
CN725425 T C 15: 91,235,802 V42A probably benign Het
Cpb1 T C 3: 20,249,814 D362G probably damaging Het
Csmd2 C A 4: 128,394,964 Q1099K probably benign Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Galnt4 A G 10: 99,110,098 M562V possibly damaging Het
Gtf3c3 T A 1: 54,406,038 E619V probably benign Het
Gucy2c A T 6: 136,723,761 M585K probably damaging Het
Hmcn1 A G 1: 150,703,216 I1993T possibly damaging Het
Lonrf2 T C 1: 38,818,123 E44G possibly damaging Het
Lrit3 A T 3: 129,800,360 F189L probably benign Het
Mag T C 7: 30,907,083 N310D possibly damaging Het
Mccc2 T C 13: 99,954,676 T151A probably damaging Het
Mybpc1 A T 10: 88,553,277 S49T probably benign Het
Myh2 A G 11: 67,194,611 E1787G probably benign Het
Ncapd3 A G 9: 27,063,416 D728G probably benign Het
Odf3 T C 7: 140,849,248 S149P probably damaging Het
Olfr651 C T 7: 104,553,335 Q139* probably null Het
Pcdhgb5 A G 18: 37,732,085 Y311C probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Rbm44 A T 1: 91,157,077 N674Y probably damaging Het
Ryr1 T C 7: 29,059,695 I3353V possibly damaging Het
Sema3c C T 5: 17,724,132 T588I possibly damaging Het
Sh2d5 A T 4: 138,259,082 E372V possibly damaging Het
Slc27a6 C T 18: 58,572,058 P171S probably benign Het
Slfn3 C T 11: 83,214,914 T579I probably benign Het
Svil T G 18: 5,049,323 V287G probably benign Het
Tas1r2 T A 4: 139,669,156 V602D probably damaging Het
Tln2 A G 9: 67,272,689 L800P probably damaging Het
Trim31 C A 17: 36,907,791 Q323K possibly damaging Het
Txndc9 T A 1: 37,990,218 D183V possibly damaging Het
Vmn2r28 T A 7: 5,488,475 M258L probably benign Het
Vmn2r75 A T 7: 86,171,576 I50N probably damaging Het
Zgrf1 A T 3: 127,588,034 N1161Y possibly damaging Het
Other mutations in Nup37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Nup37 APN 10 88158929 missense probably benign 0.00
R1486:Nup37 UTSW 10 88148254 missense probably damaging 1.00
R1646:Nup37 UTSW 10 88178234 missense possibly damaging 0.78
R4492:Nup37 UTSW 10 88174929 missense possibly damaging 0.95
R7290:Nup37 UTSW 10 88174494 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTCAATAGCCTTTCTAGGAAAGTCAC -3'
(R):5'- TTGGAACTCAAGATTGGGACG -3'

Sequencing Primer
(F):5'- GGTAGGGACATTGTAGACA -3'
(R):5'- CAAGATTGGGACGTTTCTACACC -3'
Posted On2018-05-24