Incidental Mutation 'R6441:Slfn3'
ID519028
Institutional Source Beutler Lab
Gene Symbol Slfn3
Ensembl Gene ENSMUSG00000018986
Gene Nameschlafen 3
Synonyms
MMRRC Submission
Accession Numbers

MGI: 1329005

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6441 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location83191330-83215154 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 83214914 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 579 (T579I)
Ref Sequence ENSEMBL: ENSMUSP00000150425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019130] [ENSMUST00000214041]
Predicted Effect probably benign
Transcript: ENSMUST00000019130
AA Change: T456I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000019130
Gene: ENSMUSG00000018986
AA Change: T456I

DomainStartEndE-ValueType
Pfam:AlbA_2 165 303 5.5e-11 PFAM
low complexity region 394 412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214041
AA Change: T579I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216599
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit normal immune cell populations. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl A T 3: 116,771,459 M1047K probably benign Het
Apob A T 12: 7,987,796 D322V probably damaging Het
Capn12 T A 7: 28,888,002 C438S probably benign Het
Cdh23 A T 10: 60,308,036 V2932E probably damaging Het
Cdh9 A T 15: 16,823,423 T164S probably benign Het
CN725425 T C 15: 91,235,802 V42A probably benign Het
Cpb1 T C 3: 20,249,814 D362G probably damaging Het
Csmd2 C A 4: 128,394,964 Q1099K probably benign Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Galnt4 A G 10: 99,110,098 M562V possibly damaging Het
Gtf3c3 T A 1: 54,406,038 E619V probably benign Het
Gucy2c A T 6: 136,723,761 M585K probably damaging Het
Hmcn1 A G 1: 150,703,216 I1993T possibly damaging Het
Lonrf2 T C 1: 38,818,123 E44G possibly damaging Het
Lrit3 A T 3: 129,800,360 F189L probably benign Het
Mag T C 7: 30,907,083 N310D possibly damaging Het
Mccc2 T C 13: 99,954,676 T151A probably damaging Het
Mybpc1 A T 10: 88,553,277 S49T probably benign Het
Myh2 A G 11: 67,194,611 E1787G probably benign Het
Ncapd3 A G 9: 27,063,416 D728G probably benign Het
Nup37 A G 10: 88,160,937 E139G probably benign Het
Odf3 T C 7: 140,849,248 S149P probably damaging Het
Olfr651 C T 7: 104,553,335 Q139* probably null Het
Pcdhgb5 A G 18: 37,732,085 Y311C probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Rbm44 A T 1: 91,157,077 N674Y probably damaging Het
Ryr1 T C 7: 29,059,695 I3353V possibly damaging Het
Sema3c C T 5: 17,724,132 T588I possibly damaging Het
Sh2d5 A T 4: 138,259,082 E372V possibly damaging Het
Slc27a6 C T 18: 58,572,058 P171S probably benign Het
Svil T G 18: 5,049,323 V287G probably benign Het
Tas1r2 T A 4: 139,669,156 V602D probably damaging Het
Tln2 A G 9: 67,272,689 L800P probably damaging Het
Trim31 C A 17: 36,907,791 Q323K possibly damaging Het
Txndc9 T A 1: 37,990,218 D183V possibly damaging Het
Vmn2r28 T A 7: 5,488,475 M258L probably benign Het
Vmn2r75 A T 7: 86,171,576 I50N probably damaging Het
Zgrf1 A T 3: 127,588,034 N1161Y possibly damaging Het
Other mutations in Slfn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Slfn3 APN 11 83213431 missense probably damaging 1.00
IGL01405:Slfn3 APN 11 83214716 missense possibly damaging 0.90
IGL01631:Slfn3 APN 11 83213535 missense probably damaging 0.99
IGL01944:Slfn3 APN 11 83213148 missense possibly damaging 0.59
IGL02354:Slfn3 APN 11 83213242 missense possibly damaging 0.95
IGL02361:Slfn3 APN 11 83213242 missense possibly damaging 0.95
IGL02512:Slfn3 APN 11 83213025 missense possibly damaging 0.55
IGL02875:Slfn3 APN 11 83213427 missense probably damaging 0.98
IGL02944:Slfn3 APN 11 83213011 missense probably damaging 0.99
IGL03402:Slfn3 APN 11 83213431 missense probably damaging 1.00
R0452:Slfn3 UTSW 11 83213128 missense possibly damaging 0.87
R0506:Slfn3 UTSW 11 83213160 missense probably damaging 0.99
R0560:Slfn3 UTSW 11 83213152 missense probably damaging 0.99
R0788:Slfn3 UTSW 11 83212836 missense possibly damaging 0.47
R1602:Slfn3 UTSW 11 83212715 missense probably damaging 1.00
R1713:Slfn3 UTSW 11 83213314 missense probably damaging 0.98
R1881:Slfn3 UTSW 11 83213376 missense possibly damaging 0.80
R2264:Slfn3 UTSW 11 83212972 missense probably benign 0.00
R2441:Slfn3 UTSW 11 83212683 missense probably benign 0.00
R2921:Slfn3 UTSW 11 83215045 missense probably benign 0.01
R4163:Slfn3 UTSW 11 83212770 missense probably damaging 1.00
R5099:Slfn3 UTSW 11 83214938 missense probably damaging 0.98
R5448:Slfn3 UTSW 11 83214605 missense probably damaging 0.99
R6527:Slfn3 UTSW 11 83213106 missense probably benign 0.01
R6785:Slfn3 UTSW 11 83214601 missense possibly damaging 0.73
R7128:Slfn3 UTSW 11 83214895 missense probably benign 0.00
R7344:Slfn3 UTSW 11 83212822 missense probably benign 0.28
R7528:Slfn3 UTSW 11 83214905 missense probably benign 0.01
R7763:Slfn3 UTSW 11 83214788 missense possibly damaging 0.95
R8155:Slfn3 UTSW 11 83212785 missense probably damaging 1.00
R8178:Slfn3 UTSW 11 83214679 missense probably benign 0.33
R8210:Slfn3 UTSW 11 83214506 missense possibly damaging 0.48
R8347:Slfn3 UTSW 11 83213589 missense possibly damaging 0.95
R8671:Slfn3 UTSW 11 83212999 missense probably benign 0.00
Z1176:Slfn3 UTSW 11 83213409 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAGTCTTCTTGGGGAACTAG -3'
(R):5'- AAACATCATTGTGCCATACTCC -3'

Sequencing Primer
(F):5'- TTCTTGGGGAACTAGGCGCC -3'
(R):5'- AACATCATTGTGCCATACTCCATTTG -3'
Posted On2018-05-24