Incidental Mutation 'R6441:CN725425'
ID519032
Institutional Source Beutler Lab
Gene Symbol CN725425
Ensembl Gene ENSMUSG00000078932
Gene NamecDNA sequence CN725425
SynonymsGm5807
MMRRC Submission
Accession Numbers

Ensembl: ENSMUST00000109284; MGI: 3613655

Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R6441 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location91199494-91260894 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91235802 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 42 (V42A)
Ref Sequence ENSEMBL: ENSMUSP00000140772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109284] [ENSMUST00000190436]
Predicted Effect probably benign
Transcript: ENSMUST00000109284
AA Change: V35A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104907
Gene: ENSMUSG00000078932
AA Change: V35A

DomainStartEndE-ValueType
low complexity region 21 41 N/A INTRINSIC
Pfam:DUF4552 219 643 2.7e-202 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190436
AA Change: V42A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140772
Gene: ENSMUSG00000078932
AA Change: V42A

DomainStartEndE-ValueType
low complexity region 28 48 N/A INTRINSIC
Pfam:DUF4552 226 650 1.4e-184 PFAM
Meta Mutation Damage Score 0.1069 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl A T 3: 116,771,459 M1047K probably benign Het
Apob A T 12: 7,987,796 D322V probably damaging Het
Capn12 T A 7: 28,888,002 C438S probably benign Het
Cdh23 A T 10: 60,308,036 V2932E probably damaging Het
Cdh9 A T 15: 16,823,423 T164S probably benign Het
Cpb1 T C 3: 20,249,814 D362G probably damaging Het
Csmd2 C A 4: 128,394,964 Q1099K probably benign Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Galnt4 A G 10: 99,110,098 M562V possibly damaging Het
Gtf3c3 T A 1: 54,406,038 E619V probably benign Het
Gucy2c A T 6: 136,723,761 M585K probably damaging Het
Hmcn1 A G 1: 150,703,216 I1993T possibly damaging Het
Lonrf2 T C 1: 38,818,123 E44G possibly damaging Het
Lrit3 A T 3: 129,800,360 F189L probably benign Het
Mag T C 7: 30,907,083 N310D possibly damaging Het
Mccc2 T C 13: 99,954,676 T151A probably damaging Het
Mybpc1 A T 10: 88,553,277 S49T probably benign Het
Myh2 A G 11: 67,194,611 E1787G probably benign Het
Ncapd3 A G 9: 27,063,416 D728G probably benign Het
Nup37 A G 10: 88,160,937 E139G probably benign Het
Odf3 T C 7: 140,849,248 S149P probably damaging Het
Olfr651 C T 7: 104,553,335 Q139* probably null Het
Pcdhgb5 A G 18: 37,732,085 Y311C probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Rbm44 A T 1: 91,157,077 N674Y probably damaging Het
Ryr1 T C 7: 29,059,695 I3353V possibly damaging Het
Sema3c C T 5: 17,724,132 T588I possibly damaging Het
Sh2d5 A T 4: 138,259,082 E372V possibly damaging Het
Slc27a6 C T 18: 58,572,058 P171S probably benign Het
Slfn3 C T 11: 83,214,914 T579I probably benign Het
Svil T G 18: 5,049,323 V287G probably benign Het
Tas1r2 T A 4: 139,669,156 V602D probably damaging Het
Tln2 A G 9: 67,272,689 L800P probably damaging Het
Trim31 C A 17: 36,907,791 Q323K possibly damaging Het
Txndc9 T A 1: 37,990,218 D183V possibly damaging Het
Vmn2r28 T A 7: 5,488,475 M258L probably benign Het
Vmn2r75 A T 7: 86,171,576 I50N probably damaging Het
Zgrf1 A T 3: 127,588,034 N1161Y possibly damaging Het
Other mutations in CN725425
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01541:CN725425 APN 15 91245752 missense possibly damaging 0.71
IGL02176:CN725425 APN 15 91245821 missense probably benign
3-1:CN725425 UTSW 15 91260521 missense possibly damaging 0.52
R0449:CN725425 UTSW 15 91238944 missense possibly damaging 0.73
R0554:CN725425 UTSW 15 91260763 missense possibly damaging 0.86
R1442:CN725425 UTSW 15 91238955 missense possibly damaging 0.96
R1670:CN725425 UTSW 15 91245815 missense possibly damaging 0.86
R1674:CN725425 UTSW 15 91246921 missense possibly damaging 0.93
R2425:CN725425 UTSW 15 91245855 missense probably damaging 0.97
R3966:CN725425 UTSW 15 91242687 critical splice donor site probably null
R4959:CN725425 UTSW 15 91245701 missense possibly damaging 0.92
R4973:CN725425 UTSW 15 91245701 missense possibly damaging 0.92
R5506:CN725425 UTSW 15 91235826 missense possibly damaging 0.85
R5512:CN725425 UTSW 15 91240756 missense probably benign
R5726:CN725425 UTSW 15 91260503 missense possibly damaging 0.85
R5808:CN725425 UTSW 15 91245644 missense probably benign 0.32
R5820:CN725425 UTSW 15 91260697 missense possibly damaging 0.71
R5945:CN725425 UTSW 15 91245777 missense possibly damaging 0.86
R6366:CN725425 UTSW 15 91246921 missense possibly damaging 0.93
R6484:CN725425 UTSW 15 91260572 missense probably benign 0.32
R6523:CN725425 UTSW 15 91231581 missense probably benign 0.01
R6721:CN725425 UTSW 15 91231618 missense possibly damaging 0.53
R6901:CN725425 UTSW 15 91240763 missense possibly damaging 0.93
R7341:CN725425 UTSW 15 91242670 missense possibly damaging 0.96
R7654:CN725425 UTSW 15 91239435 missense probably benign 0.04
R7704:CN725425 UTSW 15 91235790 missense possibly damaging 0.86
R7709:CN725425 UTSW 15 91240727 missense probably benign
R7880:CN725425 UTSW 15 91246105 nonsense probably null
R8371:CN725425 UTSW 15 91240770 missense probably benign 0.33
Z1088:CN725425 UTSW 15 91245762 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGTCTTTCGGCAAGCTACAAGC -3'
(R):5'- GCTAAGCTTATACTTTGAGTTCTGG -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCACTCGGGAG -3'
(R):5'- CTGGAATTTCTACCCAATTACATGGC -3'
Posted On2018-05-24