Incidental Mutation 'R6441:Pcdhgb5'
ID519035
Institutional Source Beutler Lab
Gene Symbol Pcdhgb5
Ensembl Gene ENSMUSG00000103749
Gene Nameprotocadherin gamma subfamily B, 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R6441 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location37731009-37841873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37732085 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 311 (Y311C)
Ref Sequence ENSEMBL: ENSMUSP00000142010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066149] [ENSMUST00000073447] [ENSMUST00000091935] [ENSMUST00000115661] [ENSMUST00000192511] [ENSMUST00000192535] [ENSMUST00000192931] [ENSMUST00000193414] [ENSMUST00000193869] [ENSMUST00000194190] [ENSMUST00000195112] [ENSMUST00000194544] [ENSMUST00000195363] [ENSMUST00000194418] [ENSMUST00000195823]
Predicted Effect probably benign
Transcript: ENSMUST00000066149
SMART Domains Protein: ENSMUSP00000067728
Gene: ENSMUSG00000103897

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 31 131 4.84e-2 SMART
CA 155 240 1.48e-22 SMART
CA 264 345 1.14e-23 SMART
CA 369 450 9.44e-21 SMART
CA 474 560 1.03e-26 SMART
CA 591 669 3.64e-13 SMART
Pfam:Cadherin_C_2 688 772 3e-25 PFAM
Pfam:Cadherin_tail 809 932 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073447
SMART Domains Protein: ENSMUSP00000073150
Gene: ENSMUSG00000104346

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 42 128 2.15e-2 SMART
CA 152 237 4.8e-13 SMART
CA 261 342 9.36e-25 SMART
CA 366 447 6.62e-25 SMART
CA 471 557 6.72e-26 SMART
CA 588 666 2.15e-15 SMART
Pfam:Cadherin_C_2 685 768 4.8e-24 PFAM
Pfam:Cadherin_tail 805 928 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091935
SMART Domains Protein: ENSMUSP00000089555
Gene: ENSMUSG00000102440

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 32 132 8.37e-3 SMART
CA 156 241 5.51e-22 SMART
CA 265 346 8.27e-26 SMART
CA 370 451 1.4e-23 SMART
CA 475 561 2.97e-27 SMART
CA 592 670 1.18e-12 SMART
Pfam:Cadherin_C_2 688 772 3.9e-24 PFAM
Pfam:Cadherin_tail 809 932 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192511
SMART Domains Protein: ENSMUSP00000141704
Gene: ENSMUSG00000103472

DomainStartEndE-ValueType
CA 47 133 1.57e-2 SMART
CA 157 242 3.24e-19 SMART
CA 266 347 3.21e-23 SMART
CA 371 452 9.08e-23 SMART
CA 476 562 1.32e-24 SMART
CA 593 671 3.5e-15 SMART
transmembrane domain 694 716 N/A INTRINSIC
low complexity region 916 935 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192535
AA Change: Y311C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142010
Gene: ENSMUSG00000103749
AA Change: Y311C

DomainStartEndE-ValueType
low complexity region 17 25 N/A INTRINSIC
CA 56 131 8e-3 SMART
CA 155 240 2.49e-20 SMART
CA 264 341 4.97e-29 SMART
CA 365 446 1.09e-25 SMART
CA 470 556 1.75e-24 SMART
CA 587 668 9.18e-10 SMART
transmembrane domain 687 709 N/A INTRINSIC
low complexity region 907 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192931
SMART Domains Protein: ENSMUSP00000141348
Gene: ENSMUSG00000103037

DomainStartEndE-ValueType
CA 36 119 8e-3 SMART
CA 143 228 1.34e-20 SMART
CA 252 333 1.52e-24 SMART
CA 357 438 9.22e-24 SMART
CA 462 548 1.24e-24 SMART
CA 579 660 1.3e-9 SMART
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193006
Predicted Effect probably benign
Transcript: ENSMUST00000193414
SMART Domains Protein: ENSMUSP00000141893
Gene: ENSMUSG00000103567

DomainStartEndE-ValueType
CA 45 131 2.45e-1 SMART
CA 155 240 1.05e-18 SMART
CA 264 345 6.52e-24 SMART
CA 369 450 5.99e-23 SMART
CA 474 560 6.99e-24 SMART
CA 591 669 5.31e-15 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193869
SMART Domains Protein: ENSMUSP00000141482
Gene: ENSMUSG00000103332

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 45 131 1.64e-2 SMART
CA 155 240 6.42e-23 SMART
CA 264 345 1.76e-20 SMART
CA 369 450 2.27e-23 SMART
CA 474 560 1.5e-23 SMART
CA 591 669 1.17e-16 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194190
SMART Domains Protein: ENSMUSP00000142062
Gene: ENSMUSG00000103144

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 3.16e-2 SMART
CA 155 240 5.39e-16 SMART
CA 264 345 6.72e-26 SMART
CA 369 450 1.32e-24 SMART
CA 474 560 4.17e-22 SMART
CA 591 669 4.48e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195112
SMART Domains Protein: ENSMUSP00000141449
Gene: ENSMUSG00000102748

DomainStartEndE-ValueType
CA 24 130 8.18e-3 SMART
CA 154 239 1.39e-18 SMART
CA 263 344 7.91e-23 SMART
CA 368 449 2.27e-23 SMART
CA 473 559 1.24e-24 SMART
CA 590 671 1.3e-9 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000195363
SMART Domains Protein: ENSMUSP00000142227
Gene: ENSMUSG00000103585

DomainStartEndE-ValueType
low complexity region 17 25 N/A INTRINSIC
CA 56 131 1.47e-2 SMART
CA 155 240 1.23e-19 SMART
CA 264 343 5.54e-27 SMART
CA 367 448 5.09e-26 SMART
CA 472 558 1.98e-23 SMART
CA 589 670 1.3e-9 SMART
transmembrane domain 689 711 N/A INTRINSIC
low complexity region 893 912 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194418
SMART Domains Protein: ENSMUSP00000142140
Gene: ENSMUSG00000103677

DomainStartEndE-ValueType
CA 44 130 1.64e-2 SMART
CA 154 239 3.93e-18 SMART
CA 263 344 5.22e-23 SMART
CA 368 449 5.02e-25 SMART
CA 473 559 2.07e-26 SMART
CA 590 668 6.84e-18 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195823
SMART Domains Protein: ENSMUSP00000141803
Gene: ENSMUSG00000103793

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
CA 45 131 2.41e-2 SMART
CA 155 240 5.77e-16 SMART
CA 264 345 1.1e-21 SMART
CA 369 450 2.75e-22 SMART
low complexity region 453 462 N/A INTRINSIC
CA 474 560 9.22e-24 SMART
CA 591 669 2.4e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195069
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl A T 3: 116,771,459 M1047K probably benign Het
Apob A T 12: 7,987,796 D322V probably damaging Het
Capn12 T A 7: 28,888,002 C438S probably benign Het
Cdh23 A T 10: 60,308,036 V2932E probably damaging Het
Cdh9 A T 15: 16,823,423 T164S probably benign Het
CN725425 T C 15: 91,235,802 V42A probably benign Het
Cpb1 T C 3: 20,249,814 D362G probably damaging Het
Csmd2 C A 4: 128,394,964 Q1099K probably benign Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Galnt4 A G 10: 99,110,098 M562V possibly damaging Het
Gtf3c3 T A 1: 54,406,038 E619V probably benign Het
Gucy2c A T 6: 136,723,761 M585K probably damaging Het
Hmcn1 A G 1: 150,703,216 I1993T possibly damaging Het
Lonrf2 T C 1: 38,818,123 E44G possibly damaging Het
Lrit3 A T 3: 129,800,360 F189L probably benign Het
Mag T C 7: 30,907,083 N310D possibly damaging Het
Mccc2 T C 13: 99,954,676 T151A probably damaging Het
Mybpc1 A T 10: 88,553,277 S49T probably benign Het
Myh2 A G 11: 67,194,611 E1787G probably benign Het
Ncapd3 A G 9: 27,063,416 D728G probably benign Het
Nup37 A G 10: 88,160,937 E139G probably benign Het
Odf3 T C 7: 140,849,248 S149P probably damaging Het
Olfr651 C T 7: 104,553,335 Q139* probably null Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Rbm44 A T 1: 91,157,077 N674Y probably damaging Het
Ryr1 T C 7: 29,059,695 I3353V possibly damaging Het
Sema3c C T 5: 17,724,132 T588I possibly damaging Het
Sh2d5 A T 4: 138,259,082 E372V possibly damaging Het
Slc27a6 C T 18: 58,572,058 P171S probably benign Het
Slfn3 C T 11: 83,214,914 T579I probably benign Het
Svil T G 18: 5,049,323 V287G probably benign Het
Tas1r2 T A 4: 139,669,156 V602D probably damaging Het
Tln2 A G 9: 67,272,689 L800P probably damaging Het
Trim31 C A 17: 36,907,791 Q323K possibly damaging Het
Txndc9 T A 1: 37,990,218 D183V possibly damaging Het
Vmn2r28 T A 7: 5,488,475 M258L probably benign Het
Vmn2r75 A T 7: 86,171,576 I50N probably damaging Het
Zgrf1 A T 3: 127,588,034 N1161Y possibly damaging Het
Other mutations in Pcdhgb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4200:Pcdhgb5 UTSW 18 37731982 missense possibly damaging 0.77
R4205:Pcdhgb5 UTSW 18 37732663 missense possibly damaging 0.82
R4880:Pcdhgb5 UTSW 18 37732588 missense probably benign 0.00
R5482:Pcdhgb5 UTSW 18 37731532 missense probably damaging 1.00
R5579:Pcdhgb5 UTSW 18 37731637 missense probably benign 0.25
R5683:Pcdhgb5 UTSW 18 37731854 missense probably damaging 1.00
R5699:Pcdhgb5 UTSW 18 37731917 missense probably damaging 0.99
R6127:Pcdhgb5 UTSW 18 37732879 missense probably damaging 0.99
R6216:Pcdhgb5 UTSW 18 37731928 missense probably benign 0.09
R6279:Pcdhgb5 UTSW 18 37732699 missense probably damaging 1.00
R6300:Pcdhgb5 UTSW 18 37732699 missense probably damaging 1.00
R6675:Pcdhgb5 UTSW 18 37731202 missense probably damaging 1.00
R6678:Pcdhgb5 UTSW 18 37731202 missense probably damaging 1.00
R6856:Pcdhgb5 UTSW 18 37733404 missense probably benign 0.04
R6942:Pcdhgb5 UTSW 18 37732643 missense probably damaging 1.00
R6976:Pcdhgb5 UTSW 18 37731268 missense probably damaging 1.00
R6980:Pcdhgb5 UTSW 18 37733539 missense possibly damaging 0.47
R7061:Pcdhgb5 UTSW 18 37731923 missense probably benign 0.25
R7506:Pcdhgb5 UTSW 18 37732472 missense probably damaging 1.00
R7698:Pcdhgb5 UTSW 18 37732631 missense probably damaging 1.00
R7760:Pcdhgb5 UTSW 18 37731637 missense not run
R7776:Pcdhgb5 UTSW 18 37732954 missense probably damaging 1.00
R8117:Pcdhgb5 UTSW 18 37733249 missense probably damaging 1.00
R8273:Pcdhgb5 UTSW 18 37732187 missense probably benign 0.28
R8836:Pcdhgb5 UTSW 18 37732207 missense probably benign 0.30
R8854:Pcdhgb5 UTSW 18 37732448 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGTCCGCCTTCCTGAGAAC -3'
(R):5'- TAGTCGACAATTAACCTCCCCG -3'

Sequencing Primer
(F):5'- TTCCTGAGAACGTGCCCC -3'
(R):5'- AGAATCTCCGTCGTGTATTTTGATC -3'
Posted On2018-05-24