Incidental Mutation 'R6441:Slc27a6'
ID519036
Institutional Source Beutler Lab
Gene Symbol Slc27a6
Ensembl Gene ENSMUSG00000024600
Gene Namesolute carrier family 27 (fatty acid transporter), member 6
Synonyms4732438L20Rik, FATP6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R6441 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location58556257-58612773 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 58572058 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 171 (P171S)
Ref Sequence ENSEMBL: ENSMUSP00000025500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025500]
Predicted Effect probably benign
Transcript: ENSMUST00000025500
AA Change: P171S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000025500
Gene: ENSMUSG00000024600
AA Change: P171S

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
Pfam:AMP-binding 60 487 5.3e-71 PFAM
Pfam:AMP-binding_C 495 571 2.6e-8 PFAM
Meta Mutation Damage Score 0.4455 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fatty acid transport protein family (FATP). FATPs are involved in the uptake of long-chain fatty acids and have unique expression patterns. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl A T 3: 116,771,459 M1047K probably benign Het
Apob A T 12: 7,987,796 D322V probably damaging Het
Capn12 T A 7: 28,888,002 C438S probably benign Het
Cdh23 A T 10: 60,308,036 V2932E probably damaging Het
Cdh9 A T 15: 16,823,423 T164S probably benign Het
CN725425 T C 15: 91,235,802 V42A probably benign Het
Cpb1 T C 3: 20,249,814 D362G probably damaging Het
Csmd2 C A 4: 128,394,964 Q1099K probably benign Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Galnt4 A G 10: 99,110,098 M562V possibly damaging Het
Gtf3c3 T A 1: 54,406,038 E619V probably benign Het
Gucy2c A T 6: 136,723,761 M585K probably damaging Het
Hmcn1 A G 1: 150,703,216 I1993T possibly damaging Het
Lonrf2 T C 1: 38,818,123 E44G possibly damaging Het
Lrit3 A T 3: 129,800,360 F189L probably benign Het
Mag T C 7: 30,907,083 N310D possibly damaging Het
Mccc2 T C 13: 99,954,676 T151A probably damaging Het
Mybpc1 A T 10: 88,553,277 S49T probably benign Het
Myh2 A G 11: 67,194,611 E1787G probably benign Het
Ncapd3 A G 9: 27,063,416 D728G probably benign Het
Nup37 A G 10: 88,160,937 E139G probably benign Het
Odf3 T C 7: 140,849,248 S149P probably damaging Het
Olfr651 C T 7: 104,553,335 Q139* probably null Het
Pcdhgb5 A G 18: 37,732,085 Y311C probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Rbm44 A T 1: 91,157,077 N674Y probably damaging Het
Ryr1 T C 7: 29,059,695 I3353V possibly damaging Het
Sema3c C T 5: 17,724,132 T588I possibly damaging Het
Sh2d5 A T 4: 138,259,082 E372V possibly damaging Het
Slfn3 C T 11: 83,214,914 T579I probably benign Het
Svil T G 18: 5,049,323 V287G probably benign Het
Tas1r2 T A 4: 139,669,156 V602D probably damaging Het
Tln2 A G 9: 67,272,689 L800P probably damaging Het
Trim31 C A 17: 36,907,791 Q323K possibly damaging Het
Txndc9 T A 1: 37,990,218 D183V possibly damaging Het
Vmn2r28 T A 7: 5,488,475 M258L probably benign Het
Vmn2r75 A T 7: 86,171,576 I50N probably damaging Het
Zgrf1 A T 3: 127,588,034 N1161Y possibly damaging Het
Other mutations in Slc27a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Slc27a6 APN 18 58556764 missense probably benign
IGL01419:Slc27a6 APN 18 58609209 missense probably benign 0.00
IGL01638:Slc27a6 APN 18 58607813 missense probably damaging 1.00
IGL02067:Slc27a6 APN 18 58612191 missense probably benign 0.00
IGL02612:Slc27a6 APN 18 58556905 missense probably benign 0.00
IGL03118:Slc27a6 APN 18 58556743 missense probably benign 0.00
R0096:Slc27a6 UTSW 18 58598757 splice site probably benign
R0096:Slc27a6 UTSW 18 58598757 splice site probably benign
R0255:Slc27a6 UTSW 18 58609865 missense possibly damaging 0.69
R0449:Slc27a6 UTSW 18 58609165 splice site probably null
R0599:Slc27a6 UTSW 18 58556813 missense probably damaging 1.00
R0711:Slc27a6 UTSW 18 58598757 splice site probably benign
R1082:Slc27a6 UTSW 18 58556560 missense probably damaging 0.97
R1560:Slc27a6 UTSW 18 58579832 nonsense probably null
R1942:Slc27a6 UTSW 18 58556798 missense probably damaging 0.99
R2424:Slc27a6 UTSW 18 58605117 missense probably benign 0.20
R3796:Slc27a6 UTSW 18 58598751 splice site probably benign
R4718:Slc27a6 UTSW 18 58605066 missense probably benign 0.03
R4803:Slc27a6 UTSW 18 58572033 missense possibly damaging 0.59
R5714:Slc27a6 UTSW 18 58598553 missense probably damaging 0.97
R5773:Slc27a6 UTSW 18 58582173 missense probably damaging 1.00
R5996:Slc27a6 UTSW 18 58612234 missense possibly damaging 0.89
R6049:Slc27a6 UTSW 18 58598660 missense probably damaging 1.00
R6701:Slc27a6 UTSW 18 58579875 missense probably benign 0.01
R6703:Slc27a6 UTSW 18 58609839 missense probably benign 0.19
R6809:Slc27a6 UTSW 18 58605054 missense probably benign 0.00
R7514:Slc27a6 UTSW 18 58612221 nonsense probably null
R7536:Slc27a6 UTSW 18 58556626 missense probably damaging 1.00
R7615:Slc27a6 UTSW 18 58609183 missense probably damaging 1.00
R7808:Slc27a6 UTSW 18 58609195 missense probably damaging 1.00
R8279:Slc27a6 UTSW 18 58572179 missense probably benign 0.00
R8842:Slc27a6 UTSW 18 58579816 missense probably benign 0.07
R8888:Slc27a6 UTSW 18 58582234 missense probably damaging 1.00
R8895:Slc27a6 UTSW 18 58582234 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGGGAGGCATGCCACAAG -3'
(R):5'- AACGCACCTGTTGTTCCAG -3'

Sequencing Primer
(F):5'- TGCCACAAGACAGGACAAATTTTCTC -3'
(R):5'- CACCTGTTGTTCCAGAGGTAAAAATG -3'
Posted On2018-05-24