Incidental Mutation 'R6442:Prdm11'
ID519042
Institutional Source Beutler Lab
Gene Symbol Prdm11
Ensembl Gene ENSMUSG00000075028
Gene NamePR domain containing 11
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.585) question?
Stock #R6442 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location92965151-93046167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 92975645 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 320 (A320V)
Ref Sequence ENSEMBL: ENSMUSP00000136795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111274] [ENSMUST00000178666]
Predicted Effect probably benign
Transcript: ENSMUST00000111274
AA Change: A320V

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106905
Gene: ENSMUSG00000075028
AA Change: A320V

DomainStartEndE-ValueType
SET 115 232 5.16e-2 SMART
low complexity region 369 380 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178666
AA Change: A320V

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000136795
Gene: ENSMUSG00000075028
AA Change: A320V

DomainStartEndE-ValueType
SET 115 232 5.16e-2 SMART
low complexity region 369 380 N/A INTRINSIC
Meta Mutation Damage Score 0.1200 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,144,186 T833I possibly damaging Het
Atp9a T C 2: 168,649,561 T695A probably benign Het
Btla A G 16: 45,224,458 N36D probably benign Het
Btla T C 16: 45,250,350 V224A possibly damaging Het
Cep126 T C 9: 8,100,563 N657D probably benign Het
Cops3 T A 11: 59,827,954 K171N probably benign Het
Crocc2 A G 1: 93,185,053 R193G probably benign Het
Dis3l T C 9: 64,307,555 I911V probably benign Het
Dpp6 G A 5: 27,718,509 probably null Het
Efcab5 A T 11: 77,105,434 Y1100* probably null Het
Galnt10 A G 11: 57,765,622 T211A probably benign Het
Gdf9 A G 11: 53,433,688 T95A probably benign Het
Gm826 T A 2: 160,327,408 probably benign Het
Hsd17b6 C T 10: 127,993,767 probably null Het
Hyal4 A G 6: 24,765,850 N401S probably benign Het
Itga8 C T 2: 12,230,143 V435I probably benign Het
Nr1h5 G A 3: 102,941,111 P418L probably damaging Het
Olfr1309 G A 2: 111,983,529 P182S probably damaging Het
Olfr1499 T C 19: 13,815,628 probably benign Het
Olfr399 G A 11: 74,054,679 R27W probably benign Het
Olfr732 T G 14: 50,281,369 K295Q probably damaging Het
Olfr807 C A 10: 129,755,408 G14V probably damaging Het
Ptpn5 T C 7: 47,083,083 probably null Het
Reln T A 5: 21,932,776 I2473L probably benign Het
Rmnd5a A T 6: 71,394,675 C180* probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sapcd2 T A 2: 25,376,122 probably benign Het
Sec24b A G 3: 129,996,701 L462S probably damaging Het
Slc26a9 A T 1: 131,758,817 Y425F possibly damaging Het
Sult1b1 T C 5: 87,535,053 D11G probably benign Het
Tgs1 T A 4: 3,604,760 Y727* probably null Het
Tmem80 T C 7: 141,335,926 V83A probably benign Het
Ttn T C 2: 76,721,634 T31220A probably benign Het
Usp46 A T 5: 74,016,716 D167E probably benign Het
Vmn2r67 T A 7: 85,155,838 D22V possibly damaging Het
Zswim5 C A 4: 116,951,005 P262Q probably damaging Het
Other mutations in Prdm11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01526:Prdm11 APN 2 93012757 missense probably damaging 1.00
IGL02108:Prdm11 APN 2 92975703 missense probably damaging 1.00
IGL02166:Prdm11 APN 2 93012863 missense probably damaging 1.00
IGL02369:Prdm11 APN 2 92975519 missense probably benign 0.00
IGL02388:Prdm11 APN 2 92975612 missense possibly damaging 0.90
IGL02606:Prdm11 APN 2 92975603 missense probably benign 0.02
IGL02967:Prdm11 APN 2 93012889 missense probably damaging 1.00
IGL03085:Prdm11 APN 2 92974959 missense possibly damaging 0.86
IGL03125:Prdm11 APN 2 92980622 missense probably benign 0.22
E0370:Prdm11 UTSW 2 92980579 missense probably damaging 1.00
R0607:Prdm11 UTSW 2 93013785 missense possibly damaging 0.85
R0964:Prdm11 UTSW 2 92989222 intron probably benign
R4011:Prdm11 UTSW 2 93012830 missense probably damaging 1.00
R4298:Prdm11 UTSW 2 92993383 missense probably benign 0.44
R4951:Prdm11 UTSW 2 92980609 missense probably damaging 1.00
R5150:Prdm11 UTSW 2 92975472 missense probably damaging 1.00
R5320:Prdm11 UTSW 2 93012881 missense probably benign 0.00
R5432:Prdm11 UTSW 2 92975813 missense probably benign 0.00
R6754:Prdm11 UTSW 2 93013792 missense probably damaging 1.00
R7403:Prdm11 UTSW 2 92986691 missense probably benign
R7480:Prdm11 UTSW 2 92975324 missense probably benign 0.05
R7497:Prdm11 UTSW 2 93012707 missense possibly damaging 0.93
R7633:Prdm11 UTSW 2 92980654 missense probably damaging 1.00
R7873:Prdm11 UTSW 2 92989283 missense probably benign 0.01
R7956:Prdm11 UTSW 2 92989283 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGGCGAATGCAGTTAGGAC -3'
(R):5'- CTGAGCAAGCCCTGGAAAAC -3'

Sequencing Primer
(F):5'- CAGCCTTGAATGATGTAGGCTCC -3'
(R):5'- TGGAAAACCCAGAAGACCTAAG -3'
Posted On2018-05-24