Incidental Mutation 'R6442:Rmnd5a'
ID519056
Institutional Source Beutler Lab
Gene Symbol Rmnd5a
Ensembl Gene ENSMUSG00000002222
Gene Namerequired for meiotic nuclear division 5 homolog A
Synonyms1110007A06Rik, Gid2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.892) question?
Stock #R6442 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location71388634-71440637 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 71394675 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 180 (C180*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002292]
Predicted Effect probably null
Transcript: ENSMUST00000002292
AA Change: C354*
SMART Domains Protein: ENSMUSP00000002292
Gene: ENSMUSG00000002222
AA Change: C354*

DomainStartEndE-ValueType
LisH 114 146 5.54e-5 SMART
CTLH 153 210 9.86e-11 SMART
CRA 208 302 7.07e-17 SMART
Pfam:zf-RING_UBOX 336 375 3.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144081
Predicted Effect probably null
Transcript: ENSMUST00000149415
AA Change: C180*
SMART Domains Protein: ENSMUSP00000115130
Gene: ENSMUSG00000002222
AA Change: C180*

DomainStartEndE-ValueType
CRA 35 129 7.07e-17 SMART
Pfam:zf-RING_UBOX 163 202 4e-20 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,144,186 T833I possibly damaging Het
Atp9a T C 2: 168,649,561 T695A probably benign Het
Btla A G 16: 45,224,458 N36D probably benign Het
Btla T C 16: 45,250,350 V224A possibly damaging Het
Cep126 T C 9: 8,100,563 N657D probably benign Het
Cops3 T A 11: 59,827,954 K171N probably benign Het
Crocc2 A G 1: 93,185,053 R193G probably benign Het
Dis3l T C 9: 64,307,555 I911V probably benign Het
Dpp6 G A 5: 27,718,509 probably null Het
Efcab5 A T 11: 77,105,434 Y1100* probably null Het
Galnt10 A G 11: 57,765,622 T211A probably benign Het
Gdf9 A G 11: 53,433,688 T95A probably benign Het
Gm826 T A 2: 160,327,408 probably benign Het
Hsd17b6 C T 10: 127,993,767 probably null Het
Hyal4 A G 6: 24,765,850 N401S probably benign Het
Itga8 C T 2: 12,230,143 V435I probably benign Het
Nr1h5 G A 3: 102,941,111 P418L probably damaging Het
Olfr1309 G A 2: 111,983,529 P182S probably damaging Het
Olfr1499 T C 19: 13,815,628 probably benign Het
Olfr399 G A 11: 74,054,679 R27W probably benign Het
Olfr732 T G 14: 50,281,369 K295Q probably damaging Het
Olfr807 C A 10: 129,755,408 G14V probably damaging Het
Prdm11 G A 2: 92,975,645 A320V probably benign Het
Ptpn5 T C 7: 47,083,083 probably null Het
Reln T A 5: 21,932,776 I2473L probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sapcd2 T A 2: 25,376,122 probably benign Het
Sec24b A G 3: 129,996,701 L462S probably damaging Het
Slc26a9 A T 1: 131,758,817 Y425F possibly damaging Het
Sult1b1 T C 5: 87,535,053 D11G probably benign Het
Tgs1 T A 4: 3,604,760 Y727* probably null Het
Tmem80 T C 7: 141,335,926 V83A probably benign Het
Ttn T C 2: 76,721,634 T31220A probably benign Het
Usp46 A T 5: 74,016,716 D167E probably benign Het
Vmn2r67 T A 7: 85,155,838 D22V possibly damaging Het
Zswim5 C A 4: 116,951,005 P262Q probably damaging Het
Other mutations in Rmnd5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02892:Rmnd5a APN 6 71414814 missense probably benign 0.00
IGL03264:Rmnd5a APN 6 71393135 missense probably damaging 0.99
R0046:Rmnd5a UTSW 6 71399231 missense probably damaging 0.98
R0046:Rmnd5a UTSW 6 71399231 missense probably damaging 0.98
R1295:Rmnd5a UTSW 6 71398455 missense probably benign 0.45
R1296:Rmnd5a UTSW 6 71398455 missense probably benign 0.45
R1840:Rmnd5a UTSW 6 71398455 missense probably benign 0.45
R3149:Rmnd5a UTSW 6 71429101 missense probably benign 0.02
R3735:Rmnd5a UTSW 6 71396862 missense possibly damaging 0.75
R3736:Rmnd5a UTSW 6 71396862 missense possibly damaging 0.75
R4459:Rmnd5a UTSW 6 71396881 missense probably damaging 0.98
R4532:Rmnd5a UTSW 6 71399125 critical splice donor site probably null
R4782:Rmnd5a UTSW 6 71413349 missense probably damaging 0.98
R5587:Rmnd5a UTSW 6 71394619 splice site probably benign
Predicted Primers PCR Primer
(F):5'- ATGGCTGAGCACAGTGTTAC -3'
(R):5'- GCAGTTTGAAAAGCAGTGTTG -3'

Sequencing Primer
(F):5'- TAATTCCAGTACTCAGCCATGG -3'
(R):5'- GAAAAGCAGTGTTGTAGTTTTTCAG -3'
Posted On2018-05-24