Incidental Mutation 'R6442:Hsd17b6'
ID519063
Institutional Source Beutler Lab
Gene Symbol Hsd17b6
Ensembl Gene ENSMUSG00000025396
Gene Namehydroxysteroid (17-beta) dehydrogenase 6
SynonymsRdh8, 17betaHSD9, Hsd17b9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R6442 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location127990936-128007611 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 127993767 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026462] [ENSMUST00000219183] [ENSMUST00000219447] [ENSMUST00000219707] [ENSMUST00000219780] [ENSMUST00000219953]
Predicted Effect probably null
Transcript: ENSMUST00000026462
SMART Domains Protein: ENSMUSP00000026462
Gene: ENSMUSG00000025396

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:adh_short 30 222 6.2e-40 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000219183
Predicted Effect probably null
Transcript: ENSMUST00000219447
Predicted Effect probably benign
Transcript: ENSMUST00000219707
Predicted Effect probably benign
Transcript: ENSMUST00000219780
Predicted Effect probably benign
Transcript: ENSMUST00000219953
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has both oxidoreductase and epimerase activities and is involved in androgen catabolism. The oxidoreductase activity can convert 3 alpha-adiol to dihydrotestosterone, while the epimerase activity can convert androsterone to epi-androsterone. Both reactions use NAD+ as the preferred cofactor. This gene is a member of the retinol dehydrogenase family. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,144,186 T833I possibly damaging Het
Atp9a T C 2: 168,649,561 T695A probably benign Het
Btla A G 16: 45,224,458 N36D probably benign Het
Btla T C 16: 45,250,350 V224A possibly damaging Het
Cep126 T C 9: 8,100,563 N657D probably benign Het
Cops3 T A 11: 59,827,954 K171N probably benign Het
Crocc2 A G 1: 93,185,053 R193G probably benign Het
Dis3l T C 9: 64,307,555 I911V probably benign Het
Dpp6 G A 5: 27,718,509 probably null Het
Efcab5 A T 11: 77,105,434 Y1100* probably null Het
Galnt10 A G 11: 57,765,622 T211A probably benign Het
Gdf9 A G 11: 53,433,688 T95A probably benign Het
Gm826 T A 2: 160,327,408 probably benign Het
Hyal4 A G 6: 24,765,850 N401S probably benign Het
Itga8 C T 2: 12,230,143 V435I probably benign Het
Nr1h5 G A 3: 102,941,111 P418L probably damaging Het
Olfr1309 G A 2: 111,983,529 P182S probably damaging Het
Olfr1499 T C 19: 13,815,628 probably benign Het
Olfr399 G A 11: 74,054,679 R27W probably benign Het
Olfr732 T G 14: 50,281,369 K295Q probably damaging Het
Olfr807 C A 10: 129,755,408 G14V probably damaging Het
Prdm11 G A 2: 92,975,645 A320V probably benign Het
Ptpn5 T C 7: 47,083,083 probably null Het
Reln T A 5: 21,932,776 I2473L probably benign Het
Rmnd5a A T 6: 71,394,675 C180* probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sapcd2 T A 2: 25,376,122 probably benign Het
Sec24b A G 3: 129,996,701 L462S probably damaging Het
Slc26a9 A T 1: 131,758,817 Y425F possibly damaging Het
Sult1b1 T C 5: 87,535,053 D11G probably benign Het
Tgs1 T A 4: 3,604,760 Y727* probably null Het
Tmem80 T C 7: 141,335,926 V83A probably benign Het
Ttn T C 2: 76,721,634 T31220A probably benign Het
Usp46 A T 5: 74,016,716 D167E probably benign Het
Vmn2r67 T A 7: 85,155,838 D22V possibly damaging Het
Zswim5 C A 4: 116,951,005 P262Q probably damaging Het
Other mutations in Hsd17b6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02314:Hsd17b6 APN 10 127997908 missense probably damaging 1.00
IGL03380:Hsd17b6 APN 10 127994338 unclassified probably null
IGL03399:Hsd17b6 APN 10 127993756 missense probably benign 0.00
R0277:Hsd17b6 UTSW 10 127991405 missense probably benign 0.05
R1731:Hsd17b6 UTSW 10 127994479 missense possibly damaging 0.79
R1780:Hsd17b6 UTSW 10 127994327 critical splice donor site probably null
R4357:Hsd17b6 UTSW 10 127993768 splice site probably null
R4668:Hsd17b6 UTSW 10 127994426 unclassified probably null
R4824:Hsd17b6 UTSW 10 127993655 missense probably benign
R5390:Hsd17b6 UTSW 10 127991439 missense probably benign
R5976:Hsd17b6 UTSW 10 127991439 missense probably benign
R6382:Hsd17b6 UTSW 10 127991327 missense probably damaging 0.97
R7367:Hsd17b6 UTSW 10 127993623 missense probably benign 0.02
R7597:Hsd17b6 UTSW 10 127991358 missense probably benign 0.25
R7913:Hsd17b6 UTSW 10 127997776 missense possibly damaging 0.60
R7994:Hsd17b6 UTSW 10 127997776 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- CCACATGTGCAGGGAAACAC -3'
(R):5'- AAACAGGGTTGTAGGTAGCCC -3'

Sequencing Primer
(F):5'- TGTGCAGGGAAACACACACC -3'
(R):5'- GCTGGCCCAGAATTCACTATGTAG -3'
Posted On2018-05-24