Incidental Mutation 'R6442:Gdf9'
ID519065
Institutional Source Beutler Lab
Gene Symbol Gdf9
Ensembl Gene ENSMUSG00000018238
Gene Namegrowth differentiation factor 9
SynonymsGdf-9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R6442 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location53431023-53437904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53433688 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 95 (T95A)
Ref Sequence ENSEMBL: ENSMUSP00000018382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018382] [ENSMUST00000061326] [ENSMUST00000109019] [ENSMUST00000109021]
Predicted Effect probably benign
Transcript: ENSMUST00000018382
AA Change: T95A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000018382
Gene: ENSMUSG00000018238
AA Change: T95A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TGFB 340 441 3.16e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061326
SMART Domains Protein: ENSMUSP00000053145
Gene: ENSMUSG00000044894

DomainStartEndE-ValueType
Pfam:UcrQ 2 81 3.7e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109019
Predicted Effect probably benign
Transcript: ENSMUST00000109021
SMART Domains Protein: ENSMUSP00000104649
Gene: ENSMUSG00000044894

DomainStartEndE-ValueType
Pfam:UcrQ 2 81 3.7e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156503
Meta Mutation Damage Score 0.0755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates ovarian function. Female mice that are homozygous null for this gene are sterile with impaired folliculogenesis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Females homozygous for a targeted null mutation are sterile with a block in folliculogenesis. Mutant oocytes exhibit perinuclear organelle aggregation, unusual Golgi complexes, absence of cortical granules, and impaired granulosa cell connections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,144,186 T833I possibly damaging Het
Atp9a T C 2: 168,649,561 T695A probably benign Het
Btla A G 16: 45,224,458 N36D probably benign Het
Btla T C 16: 45,250,350 V224A possibly damaging Het
Cep126 T C 9: 8,100,563 N657D probably benign Het
Cops3 T A 11: 59,827,954 K171N probably benign Het
Crocc2 A G 1: 93,185,053 R193G probably benign Het
Dis3l T C 9: 64,307,555 I911V probably benign Het
Dpp6 G A 5: 27,718,509 probably null Het
Efcab5 A T 11: 77,105,434 Y1100* probably null Het
Galnt10 A G 11: 57,765,622 T211A probably benign Het
Gm826 T A 2: 160,327,408 probably benign Het
Hsd17b6 C T 10: 127,993,767 probably null Het
Hyal4 A G 6: 24,765,850 N401S probably benign Het
Itga8 C T 2: 12,230,143 V435I probably benign Het
Nr1h5 G A 3: 102,941,111 P418L probably damaging Het
Olfr1309 G A 2: 111,983,529 P182S probably damaging Het
Olfr1499 T C 19: 13,815,628 probably benign Het
Olfr399 G A 11: 74,054,679 R27W probably benign Het
Olfr732 T G 14: 50,281,369 K295Q probably damaging Het
Olfr807 C A 10: 129,755,408 G14V probably damaging Het
Prdm11 G A 2: 92,975,645 A320V probably benign Het
Ptpn5 T C 7: 47,083,083 probably null Het
Reln T A 5: 21,932,776 I2473L probably benign Het
Rmnd5a A T 6: 71,394,675 C180* probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sapcd2 T A 2: 25,376,122 probably benign Het
Sec24b A G 3: 129,996,701 L462S probably damaging Het
Slc26a9 A T 1: 131,758,817 Y425F possibly damaging Het
Sult1b1 T C 5: 87,535,053 D11G probably benign Het
Tgs1 T A 4: 3,604,760 Y727* probably null Het
Tmem80 T C 7: 141,335,926 V83A probably benign Het
Ttn T C 2: 76,721,634 T31220A probably benign Het
Usp46 A T 5: 74,016,716 D167E probably benign Het
Vmn2r67 T A 7: 85,155,838 D22V possibly damaging Het
Zswim5 C A 4: 116,951,005 P262Q probably damaging Het
Other mutations in Gdf9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02148:Gdf9 APN 11 53436742 missense probably benign 0.02
R0688:Gdf9 UTSW 11 53436640 missense probably damaging 1.00
R1607:Gdf9 UTSW 11 53437511 missense possibly damaging 0.79
R1651:Gdf9 UTSW 11 53433749 missense probably damaging 0.98
R1902:Gdf9 UTSW 11 53436953 missense probably benign 0.26
R2128:Gdf9 UTSW 11 53437507 missense probably damaging 1.00
R5360:Gdf9 UTSW 11 53437207 missense probably benign 0.42
R5391:Gdf9 UTSW 11 53433797 missense probably benign
R5395:Gdf9 UTSW 11 53433797 missense probably benign
R5470:Gdf9 UTSW 11 53436754 missense probably benign 0.11
R5593:Gdf9 UTSW 11 53433731 missense probably damaging 0.99
R5809:Gdf9 UTSW 11 53433554 missense probably benign 0.03
R5829:Gdf9 UTSW 11 53433689 missense probably benign 0.03
R6394:Gdf9 UTSW 11 53436697 missense probably damaging 1.00
R6894:Gdf9 UTSW 11 53436819 missense possibly damaging 0.80
R7171:Gdf9 UTSW 11 53437539 missense probably damaging 1.00
R7650:Gdf9 UTSW 11 53437098 missense probably benign 0.06
Z1176:Gdf9 UTSW 11 53437525 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAAGAATCCCAGAGTGGAGC -3'
(R):5'- CAAATCAAAGTGTGGCTCCTTC -3'

Sequencing Primer
(F):5'- ATCCCAGAGTGGAGCCAGTG -3'
(R):5'- CAAAGTGTGGCTCCTTCTGGTAAC -3'
Posted On2018-05-24