Incidental Mutation 'R6442:Olfr732'
ID519070
Institutional Source Beutler Lab
Gene Symbol Olfr732
Ensembl Gene ENSMUSG00000091873
Gene Nameolfactory receptor 732
SynonymsGA_x6K02T2PMLR-5975274-5974348, MOR241-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R6442 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location50278473-50284206 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 50281369 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 295 (K295Q)
Ref Sequence ENSEMBL: ENSMUSP00000148984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071208] [ENSMUST00000213701]
Predicted Effect probably damaging
Transcript: ENSMUST00000071208
AA Change: K295Q

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071195
Gene: ENSMUSG00000091873
AA Change: K295Q

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 7.4e-45 PFAM
Pfam:7tm_1 41 288 4.5e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213701
AA Change: K295Q

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.2888 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,144,186 T833I possibly damaging Het
Atp9a T C 2: 168,649,561 T695A probably benign Het
Btla A G 16: 45,224,458 N36D probably benign Het
Btla T C 16: 45,250,350 V224A possibly damaging Het
Cep126 T C 9: 8,100,563 N657D probably benign Het
Cops3 T A 11: 59,827,954 K171N probably benign Het
Crocc2 A G 1: 93,185,053 R193G probably benign Het
Dis3l T C 9: 64,307,555 I911V probably benign Het
Dpp6 G A 5: 27,718,509 probably null Het
Efcab5 A T 11: 77,105,434 Y1100* probably null Het
Galnt10 A G 11: 57,765,622 T211A probably benign Het
Gdf9 A G 11: 53,433,688 T95A probably benign Het
Gm826 T A 2: 160,327,408 probably benign Het
Hsd17b6 C T 10: 127,993,767 probably null Het
Hyal4 A G 6: 24,765,850 N401S probably benign Het
Itga8 C T 2: 12,230,143 V435I probably benign Het
Nr1h5 G A 3: 102,941,111 P418L probably damaging Het
Olfr1309 G A 2: 111,983,529 P182S probably damaging Het
Olfr1499 T C 19: 13,815,628 probably benign Het
Olfr399 G A 11: 74,054,679 R27W probably benign Het
Olfr807 C A 10: 129,755,408 G14V probably damaging Het
Prdm11 G A 2: 92,975,645 A320V probably benign Het
Ptpn5 T C 7: 47,083,083 probably null Het
Reln T A 5: 21,932,776 I2473L probably benign Het
Rmnd5a A T 6: 71,394,675 C180* probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sapcd2 T A 2: 25,376,122 probably benign Het
Sec24b A G 3: 129,996,701 L462S probably damaging Het
Slc26a9 A T 1: 131,758,817 Y425F possibly damaging Het
Sult1b1 T C 5: 87,535,053 D11G probably benign Het
Tgs1 T A 4: 3,604,760 Y727* probably null Het
Tmem80 T C 7: 141,335,926 V83A probably benign Het
Ttn T C 2: 76,721,634 T31220A probably benign Het
Usp46 A T 5: 74,016,716 D167E probably benign Het
Vmn2r67 T A 7: 85,155,838 D22V possibly damaging Het
Zswim5 C A 4: 116,951,005 P262Q probably damaging Het
Other mutations in Olfr732
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Olfr732 APN 14 50282232 missense probably damaging 0.99
IGL01801:Olfr732 APN 14 50282208 missense probably benign
IGL01992:Olfr732 APN 14 50281341 missense probably benign 0.09
IGL02137:Olfr732 APN 14 50281678 missense probably benign 0.16
IGL02494:Olfr732 APN 14 50282226 missense probably damaging 1.00
IGL02606:Olfr732 APN 14 50282073 missense probably damaging 1.00
IGL02799:Olfr732 UTSW 14 50281344 missense probably benign
PIT4142001:Olfr732 UTSW 14 50281327 makesense probably null
R0570:Olfr732 UTSW 14 50281913 missense probably benign 0.00
R1570:Olfr732 UTSW 14 50281524 missense probably damaging 1.00
R1860:Olfr732 UTSW 14 50281391 nonsense probably null
R2313:Olfr732 UTSW 14 50281974 missense probably damaging 1.00
R4594:Olfr732 UTSW 14 50281683 missense probably benign 0.02
R6783:Olfr732 UTSW 14 50282187 missense probably benign
R7334:Olfr732 UTSW 14 50281579 missense probably benign 0.08
R7763:Olfr732 UTSW 14 50281488 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTACATAACTGTGTCAAATTGCC -3'
(R):5'- TCCTATGCAGTTATTTTATGCCATG -3'

Sequencing Primer
(F):5'- GCCTATATCCTTCCTGAAAAATGAG -3'
(R):5'- ATGCCATGTTCACAGGTCAG -3'
Posted On2018-05-24