Incidental Mutation 'R6442:Btla'
ID519071
Institutional Source Beutler Lab
Gene Symbol Btla
Ensembl Gene ENSMUSG00000052013
Gene NameB and T lymphocyte associated
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R6442 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location45224315-45257670 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45224458 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 36 (N36D)
Ref Sequence ENSEMBL: ENSMUSP00000099866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063654] [ENSMUST00000102802]
Predicted Effect probably benign
Transcript: ENSMUST00000063654
AA Change: N36D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000067877
Gene: ENSMUSG00000052013
AA Change: N36D

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IG 49 143 2.92e-5 SMART
transmembrane domain 182 204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102802
AA Change: N36D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099866
Gene: ENSMUSG00000052013
AA Change: N36D

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IG 49 143 2.92e-5 SMART
transmembrane domain 181 203 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin superfamily. The encoded protein contains a single immunoglobulin (Ig) domain and is a receptor that relays inhibitory signals to suppress the immune response. Alternative splicing results in multiple transcript variants. Polymorphisms in this gene have been associated with an increased risk of rheumatoid arthritis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Targeted inactivation of this gene leads to increased T cell activation. Homozygotes for a null allele show altered peripheral T cell anergy. Homozygotes for a different null allele show enhanced specific antibody responses, increased susceptibility to EAE, and prolonged allograft survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,144,186 T833I possibly damaging Het
Atp9a T C 2: 168,649,561 T695A probably benign Het
Cep126 T C 9: 8,100,563 N657D probably benign Het
Cops3 T A 11: 59,827,954 K171N probably benign Het
Crocc2 A G 1: 93,185,053 R193G probably benign Het
Dis3l T C 9: 64,307,555 I911V probably benign Het
Dpp6 G A 5: 27,718,509 probably null Het
Efcab5 A T 11: 77,105,434 Y1100* probably null Het
Galnt10 A G 11: 57,765,622 T211A probably benign Het
Gdf9 A G 11: 53,433,688 T95A probably benign Het
Gm826 T A 2: 160,327,408 probably benign Het
Hsd17b6 C T 10: 127,993,767 probably null Het
Hyal4 A G 6: 24,765,850 N401S probably benign Het
Itga8 C T 2: 12,230,143 V435I probably benign Het
Nr1h5 G A 3: 102,941,111 P418L probably damaging Het
Olfr1309 G A 2: 111,983,529 P182S probably damaging Het
Olfr1499 T C 19: 13,815,628 probably benign Het
Olfr399 G A 11: 74,054,679 R27W probably benign Het
Olfr732 T G 14: 50,281,369 K295Q probably damaging Het
Olfr807 C A 10: 129,755,408 G14V probably damaging Het
Prdm11 G A 2: 92,975,645 A320V probably benign Het
Ptpn5 T C 7: 47,083,083 probably null Het
Reln T A 5: 21,932,776 I2473L probably benign Het
Rmnd5a A T 6: 71,394,675 C180* probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sapcd2 T A 2: 25,376,122 probably benign Het
Sec24b A G 3: 129,996,701 L462S probably damaging Het
Slc26a9 A T 1: 131,758,817 Y425F possibly damaging Het
Sult1b1 T C 5: 87,535,053 D11G probably benign Het
Tgs1 T A 4: 3,604,760 Y727* probably null Het
Tmem80 T C 7: 141,335,926 V83A probably benign Het
Ttn T C 2: 76,721,634 T31220A probably benign Het
Usp46 A T 5: 74,016,716 D167E probably benign Het
Vmn2r67 T A 7: 85,155,838 D22V possibly damaging Het
Zswim5 C A 4: 116,951,005 P262Q probably damaging Het
Other mutations in Btla
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Btla APN 16 45250353 missense probably benign 0.34
IGL01774:Btla APN 16 45250548 missense possibly damaging 0.78
IGL03252:Btla APN 16 45239146 missense possibly damaging 0.56
IGL03266:Btla APN 16 45239275 missense probably damaging 0.98
Conundrum UTSW 16 45239298 missense probably damaging 1.00
Enigmatic UTSW 16 45239039 splice site probably null
Mysterious UTSW 16 45250573 nonsense probably null
R1373:Btla UTSW 16 45224420 missense probably benign 0.09
R1864:Btla UTSW 16 45250374 missense probably damaging 0.97
R2439:Btla UTSW 16 45239140 missense probably damaging 1.00
R4133:Btla UTSW 16 45239298 missense probably damaging 1.00
R4193:Btla UTSW 16 45250482 missense probably benign 0.00
R4948:Btla UTSW 16 45242728 missense probably benign 0.33
R5597:Btla UTSW 16 45244236 missense probably benign
R5666:Btla UTSW 16 45250419 missense probably damaging 1.00
R5670:Btla UTSW 16 45250419 missense probably damaging 1.00
R5700:Btla UTSW 16 45250573 nonsense probably null
R5859:Btla UTSW 16 45239039 splice site probably null
R6442:Btla UTSW 16 45250350 missense possibly damaging 0.82
R6526:Btla UTSW 16 45239094 missense probably damaging 1.00
R6883:Btla UTSW 16 45242729 missense probably benign 0.09
R8016:Btla UTSW 16 45250587 missense probably damaging 0.99
Z1176:Btla UTSW 16 45239358 missense probably damaging 0.98
Z1177:Btla UTSW 16 45239272 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GTGACCCAGCTCTGAAGATC -3'
(R):5'- GGACCTGGTTTTAGGAAACTTAGC -3'

Sequencing Primer
(F):5'- GTGACCCAGCTCTGAAGATCTCTAG -3'
(R):5'- CAGGTGAGTAGCATGTCCTAACTTC -3'
Posted On2018-05-24