Incidental Mutation 'R6443:Olfr1019'
ID519075
Institutional Source Beutler Lab
Gene Symbol Olfr1019
Ensembl Gene ENSMUSG00000075208
Gene Nameolfactory receptor 1019
SynonymsMOR180-1, GA_x6K02T2Q125-47320309-47319377
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R6443 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location85839621-85845483 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 85841635 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 52 (D52A)
Ref Sequence ENSEMBL: ENSMUSP00000150622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102634] [ENSMUST00000213515]
Predicted Effect probably damaging
Transcript: ENSMUST00000102634
AA Change: D52A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099694
Gene: ENSMUSG00000075208
AA Change: D52A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.7e-55 PFAM
Pfam:7TM_GPCR_Srsx 35 237 1.6e-6 PFAM
Pfam:7tm_1 41 290 1.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213515
AA Change: D52A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.9%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A G 9: 4,309,357 L27P probably damaging Het
Actr6 T C 10: 89,714,871 N354D probably damaging Het
Apbb1 T A 7: 105,573,763 N214Y probably damaging Het
Bcar1 A T 8: 111,715,338 V290E probably damaging Het
Ces1f T A 8: 93,275,365 Q45L probably benign Het
Ctss A C 3: 95,546,803 K221T probably benign Het
Dclre1b T A 3: 103,803,188 N469I possibly damaging Het
Dnah12 C A 14: 26,878,051 Q3683K probably benign Het
Dnah8 A G 17: 30,771,885 I3301V probably benign Het
Ephb4 G A 5: 137,360,449 G298E probably damaging Het
Eya3 T C 4: 132,711,927 F455L probably damaging Het
Fkbp5 G T 17: 28,429,279 A112D probably damaging Het
Glud1 T C 14: 34,339,927 M468T probably benign Het
Gm5114 C A 7: 39,407,717 R826L possibly damaging Het
Gramd3 G A 18: 56,485,385 V222I probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Lpin2 T C 17: 71,241,668 S576P probably benign Het
Lrrc1 A G 9: 77,434,032 F415L probably damaging Het
Mtmr3 A T 11: 4,487,358 I1032K probably damaging Het
Nr5a1 G A 2: 38,710,430 T75M probably damaging Het
Nwd1 G A 8: 72,662,366 V141I possibly damaging Het
Olfr22-ps1 A T 11: 73,955,092 Q134L probably benign Het
Olfr807 C A 10: 129,755,408 G14V probably damaging Het
Pla1a T C 16: 38,409,587 probably null Het
Ppp1r36 A G 12: 76,417,639 S4G probably benign Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Ryr1 A T 7: 29,077,078 M2204K probably damaging Het
Ryr3 T C 2: 112,675,933 N3428S possibly damaging Het
Slc6a4 A G 11: 77,023,201 K526E probably benign Het
Slc9a8 G A 2: 167,434,821 R78H probably benign Het
Sptbn1 T C 11: 30,139,429 D611G possibly damaging Het
Sstr2 G A 11: 113,625,254 probably null Het
Tcf7 G T 11: 52,253,938 T286N probably benign Het
Txndc5 A G 13: 38,528,203 M69T possibly damaging Het
Usp48 T A 4: 137,613,763 V358E probably damaging Het
Vmn2r1 T A 3: 64,104,953 I745K possibly damaging Het
Zfp354b A G 11: 50,922,754 I448T possibly damaging Het
Zfp523 A T 17: 28,201,407 T189S probably damaging Het
Other mutations in Olfr1019
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Olfr1019 APN 2 85841362 missense probably benign 0.02
IGL02734:Olfr1019 APN 2 85841539 missense possibly damaging 0.88
IGL03030:Olfr1019 APN 2 85841072 missense probably damaging 1.00
IGL03207:Olfr1019 APN 2 85840973 missense probably benign 0.14
IGL03215:Olfr1019 APN 2 85841381 missense probably damaging 1.00
IGL03220:Olfr1019 APN 2 85840982 missense possibly damaging 0.87
R0441:Olfr1019 UTSW 2 85841515 missense probably damaging 1.00
R4013:Olfr1019 UTSW 2 85841381 missense probably damaging 1.00
R4604:Olfr1019 UTSW 2 85841182 missense probably damaging 0.99
R5307:Olfr1019 UTSW 2 85841014 missense probably damaging 1.00
R5754:Olfr1019 UTSW 2 85841312 missense probably damaging 1.00
R6010:Olfr1019 UTSW 2 85841561 missense probably benign 0.16
R6062:Olfr1019 UTSW 2 85841114 missense probably benign
R6103:Olfr1019 UTSW 2 85841432 missense probably damaging 1.00
R7442:Olfr1019 UTSW 2 85841752 missense probably benign 0.04
R7490:Olfr1019 UTSW 2 85840963 missense probably damaging 1.00
R7524:Olfr1019 UTSW 2 85841357 missense probably benign
R7605:Olfr1019 UTSW 2 85841039 missense probably benign 0.34
R7615:Olfr1019 UTSW 2 85841657 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTCTGCAGATGGCCACAAAG -3'
(R):5'- CACTCACTGCTTAGAACAATGG -3'

Sequencing Primer
(F):5'- CAAAGCGGTCATAGGCCATTGC -3'
(R):5'- CTCACTGCTTAGAACAATGGATAAAG -3'
Posted On2018-05-24