Incidental Mutation 'R6443:Slc9a8'
ID519077
Institutional Source Beutler Lab
Gene Symbol Slc9a8
Ensembl Gene ENSMUSG00000039463
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 8
Synonyms1200006P13Rik, 6430709P13Rik, NHE8
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6443 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location167421712-167477000 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 167434821 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 78 (R78H)
Ref Sequence ENSEMBL: ENSMUSP00000044185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047815] [ENSMUST00000073873] [ENSMUST00000109218]
Predicted Effect probably benign
Transcript: ENSMUST00000047815
AA Change: R78H

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000044185
Gene: ENSMUSG00000039463
AA Change: R78H

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 57 468 3.3e-69 PFAM
low complexity region 497 513 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073873
SMART Domains Protein: ENSMUSP00000073536
Gene: ENSMUSG00000039463

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 54 441 3.5e-62 PFAM
low complexity region 470 486 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109218
SMART Domains Protein: ENSMUSP00000104841
Gene: ENSMUSG00000039463

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 54 437 3.7e-61 PFAM
low complexity region 466 482 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149607
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.9%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: This gene encodes a member of the Na+/H+ exchanger (NHE) family of integral membrane transporter proteins. The encoded protein is expressed on the apical membrane of the intestinal epithelial cells and plays an important role in mucosal protection. Loss of the encoded protein in mice results in a decrease in the number of goblet and mucin-positive cells, disorganization of the mucin layer, and a decrease in mucosal pH in the colon. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male infertility, impaired mucin synthesis and bicarbonate secretion in the colon, abnormal blood coagulation and increased length of the small intestine, cecum and ileum crypts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A G 9: 4,309,357 L27P probably damaging Het
Actr6 T C 10: 89,714,871 N354D probably damaging Het
Apbb1 T A 7: 105,573,763 N214Y probably damaging Het
Bcar1 A T 8: 111,715,338 V290E probably damaging Het
Ces1f T A 8: 93,275,365 Q45L probably benign Het
Ctss A C 3: 95,546,803 K221T probably benign Het
Dclre1b T A 3: 103,803,188 N469I possibly damaging Het
Dnah12 C A 14: 26,878,051 Q3683K probably benign Het
Dnah8 A G 17: 30,771,885 I3301V probably benign Het
Ephb4 G A 5: 137,360,449 G298E probably damaging Het
Eya3 T C 4: 132,711,927 F455L probably damaging Het
Fkbp5 G T 17: 28,429,279 A112D probably damaging Het
Glud1 T C 14: 34,339,927 M468T probably benign Het
Gm5114 C A 7: 39,407,717 R826L possibly damaging Het
Gramd3 G A 18: 56,485,385 V222I probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Lpin2 T C 17: 71,241,668 S576P probably benign Het
Lrrc1 A G 9: 77,434,032 F415L probably damaging Het
Mtmr3 A T 11: 4,487,358 I1032K probably damaging Het
Nr5a1 G A 2: 38,710,430 T75M probably damaging Het
Nwd1 G A 8: 72,662,366 V141I possibly damaging Het
Olfr1019 T G 2: 85,841,635 D52A probably damaging Het
Olfr22-ps1 A T 11: 73,955,092 Q134L probably benign Het
Olfr807 C A 10: 129,755,408 G14V probably damaging Het
Pla1a T C 16: 38,409,587 probably null Het
Ppp1r36 A G 12: 76,417,639 S4G probably benign Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Ryr1 A T 7: 29,077,078 M2204K probably damaging Het
Ryr3 T C 2: 112,675,933 N3428S possibly damaging Het
Slc6a4 A G 11: 77,023,201 K526E probably benign Het
Sptbn1 T C 11: 30,139,429 D611G possibly damaging Het
Sstr2 G A 11: 113,625,254 probably null Het
Tcf7 G T 11: 52,253,938 T286N probably benign Het
Txndc5 A G 13: 38,528,203 M69T possibly damaging Het
Usp48 T A 4: 137,613,763 V358E probably damaging Het
Vmn2r1 T A 3: 64,104,953 I745K possibly damaging Het
Zfp354b A G 11: 50,922,754 I448T possibly damaging Het
Zfp523 A T 17: 28,201,407 T189S probably damaging Het
Other mutations in Slc9a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Slc9a8 APN 2 167424166 missense possibly damaging 0.46
IGL02626:Slc9a8 APN 2 167467677 splice site probably benign
costello UTSW 2 167451296 missense probably damaging 1.00
R0270:Slc9a8 UTSW 2 167451296 missense probably damaging 1.00
R0417:Slc9a8 UTSW 2 167457344 missense probably benign 0.00
R0504:Slc9a8 UTSW 2 167424205 missense probably benign
R0906:Slc9a8 UTSW 2 167434867 intron probably benign
R1216:Slc9a8 UTSW 2 167424121 missense probably benign 0.00
R1225:Slc9a8 UTSW 2 167471523 missense probably benign 0.20
R1604:Slc9a8 UTSW 2 167471432 missense probably benign 0.09
R1728:Slc9a8 UTSW 2 167424145 missense probably benign 0.00
R1729:Slc9a8 UTSW 2 167424145 missense probably benign 0.00
R1773:Slc9a8 UTSW 2 167471465 missense possibly damaging 0.57
R1775:Slc9a8 UTSW 2 167457358 missense probably benign 0.12
R1918:Slc9a8 UTSW 2 167424214 missense possibly damaging 0.95
R2312:Slc9a8 UTSW 2 167451276 missense probably benign 0.01
R3031:Slc9a8 UTSW 2 167451281 missense probably damaging 1.00
R3752:Slc9a8 UTSW 2 167457352 missense probably benign
R3757:Slc9a8 UTSW 2 167424130 missense probably benign 0.01
R4499:Slc9a8 UTSW 2 167424193 missense probably benign 0.01
R4746:Slc9a8 UTSW 2 167441170 nonsense probably null
R4904:Slc9a8 UTSW 2 167471396 missense possibly damaging 0.51
R4969:Slc9a8 UTSW 2 167446529 missense probably benign 0.06
R5395:Slc9a8 UTSW 2 167467722 missense probably damaging 0.99
R5811:Slc9a8 UTSW 2 167471387 nonsense probably null
R5908:Slc9a8 UTSW 2 167451170 intron probably benign
R6311:Slc9a8 UTSW 2 167451220 missense probably damaging 1.00
R6494:Slc9a8 UTSW 2 167424291 missense probably damaging 1.00
R7161:Slc9a8 UTSW 2 167465383 missense possibly damaging 0.90
R7322:Slc9a8 UTSW 2 167451302 missense probably damaging 1.00
R7354:Slc9a8 UTSW 2 167474131 missense possibly damaging 0.93
R7896:Slc9a8 UTSW 2 167465358 missense probably benign 0.07
R8095:Slc9a8 UTSW 2 167468971 missense probably damaging 0.99
R8725:Slc9a8 UTSW 2 167473534 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTGTGGCAAATGCAGACCC -3'
(R):5'- GAGTTTCCTCGTTCACAATCAAC -3'

Sequencing Primer
(F):5'- TAGTGAGAATCAGACTCTGGGTCCC -3'
(R):5'- GTTTCCTCGTTCACAATCAACCAAAC -3'
Posted On2018-05-24