Incidental Mutation 'R6443:Eya3'
ID519081
Institutional Source Beutler Lab
Gene Symbol Eya3
Ensembl Gene ENSMUSG00000028886
Gene NameEYA transcriptional coactivator and phosphatase 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.810) question?
Stock #R6443 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location132638987-132724765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132711927 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 455 (F455L)
Ref Sequence ENSEMBL: ENSMUSP00000080425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020197] [ENSMUST00000079157] [ENSMUST00000081726] [ENSMUST00000180250]
Predicted Effect probably damaging
Transcript: ENSMUST00000020197
AA Change: F345L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020197
Gene: ENSMUSG00000028886
AA Change: F345L

DomainStartEndE-ValueType
low complexity region 19 38 N/A INTRINSIC
low complexity region 71 83 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
PDB:4EGC|B 132 416 1e-136 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000079157
AA Change: F439L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078157
Gene: ENSMUSG00000028886
AA Change: F439L

DomainStartEndE-ValueType
low complexity region 72 89 N/A INTRINSIC
low complexity region 113 132 N/A INTRINSIC
low complexity region 165 177 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
PDB:4EGC|B 226 510 1e-135 PDB
SCOP:d1lvha_ 345 507 8e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081726
AA Change: F455L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080425
Gene: ENSMUSG00000028886
AA Change: F455L

DomainStartEndE-ValueType
low complexity region 88 105 N/A INTRINSIC
low complexity region 129 148 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
low complexity region 208 219 N/A INTRINSIC
Pfam:Hydrolase 256 502 5.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157029
Predicted Effect probably damaging
Transcript: ENSMUST00000180250
AA Change: F345L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136812
Gene: ENSMUSG00000028886
AA Change: F345L

DomainStartEndE-ValueType
low complexity region 19 38 N/A INTRINSIC
low complexity region 71 83 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
PDB:4EGC|B 132 416 1e-136 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.9%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may act as a transcriptional activator and have a role during development. It can act as a mediator of chemoresistance and cell survival in Ewing sarcoma cells, where this gene is up-regulated via a micro-RNA that binds to the 3' UTR of the transcript. A similar protein in mice acts as a transcriptional activator. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit abnormal heart function, decreased grip strength and increased exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A G 9: 4,309,357 L27P probably damaging Het
Actr6 T C 10: 89,714,871 N354D probably damaging Het
Apbb1 T A 7: 105,573,763 N214Y probably damaging Het
Bcar1 A T 8: 111,715,338 V290E probably damaging Het
Ces1f T A 8: 93,275,365 Q45L probably benign Het
Ctss A C 3: 95,546,803 K221T probably benign Het
Dclre1b T A 3: 103,803,188 N469I possibly damaging Het
Dnah12 C A 14: 26,878,051 Q3683K probably benign Het
Dnah8 A G 17: 30,771,885 I3301V probably benign Het
Ephb4 G A 5: 137,360,449 G298E probably damaging Het
Fkbp5 G T 17: 28,429,279 A112D probably damaging Het
Glud1 T C 14: 34,339,927 M468T probably benign Het
Gm5114 C A 7: 39,407,717 R826L possibly damaging Het
Gramd3 G A 18: 56,485,385 V222I probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Lpin2 T C 17: 71,241,668 S576P probably benign Het
Lrrc1 A G 9: 77,434,032 F415L probably damaging Het
Mtmr3 A T 11: 4,487,358 I1032K probably damaging Het
Nr5a1 G A 2: 38,710,430 T75M probably damaging Het
Nwd1 G A 8: 72,662,366 V141I possibly damaging Het
Olfr1019 T G 2: 85,841,635 D52A probably damaging Het
Olfr22-ps1 A T 11: 73,955,092 Q134L probably benign Het
Olfr807 C A 10: 129,755,408 G14V probably damaging Het
Pla1a T C 16: 38,409,587 probably null Het
Ppp1r36 A G 12: 76,417,639 S4G probably benign Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Ryr1 A T 7: 29,077,078 M2204K probably damaging Het
Ryr3 T C 2: 112,675,933 N3428S possibly damaging Het
Slc6a4 A G 11: 77,023,201 K526E probably benign Het
Slc9a8 G A 2: 167,434,821 R78H probably benign Het
Sptbn1 T C 11: 30,139,429 D611G possibly damaging Het
Sstr2 G A 11: 113,625,254 probably null Het
Tcf7 G T 11: 52,253,938 T286N probably benign Het
Txndc5 A G 13: 38,528,203 M69T possibly damaging Het
Usp48 T A 4: 137,613,763 V358E probably damaging Het
Vmn2r1 T A 3: 64,104,953 I745K possibly damaging Het
Zfp354b A G 11: 50,922,754 I448T possibly damaging Het
Zfp523 A T 17: 28,201,407 T189S probably damaging Het
Other mutations in Eya3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Eya3 APN 4 132704398 missense probably damaging 1.00
IGL01104:Eya3 APN 4 132711929 missense probably damaging 1.00
IGL01109:Eya3 APN 4 132693000 nonsense probably null
IGL01145:Eya3 APN 4 132709995 missense probably damaging 1.00
IGL02364:Eya3 APN 4 132710055 missense probably damaging 1.00
IGL03008:Eya3 APN 4 132706983 missense probably damaging 1.00
IGL03144:Eya3 APN 4 132693142 missense probably benign 0.07
IGL03176:Eya3 APN 4 132711922 missense possibly damaging 0.90
R0279:Eya3 UTSW 4 132719247 missense probably damaging 1.00
R0621:Eya3 UTSW 4 132694802 missense probably benign 0.00
R0893:Eya3 UTSW 4 132689786 missense probably benign 0.01
R1416:Eya3 UTSW 4 132707129 splice site probably benign
R1834:Eya3 UTSW 4 132707118 missense probably damaging 0.99
R1903:Eya3 UTSW 4 132721352 splice site probably null
R4696:Eya3 UTSW 4 132670232 nonsense probably null
R4739:Eya3 UTSW 4 132721387 utr 3 prime probably benign
R4758:Eya3 UTSW 4 132694885 critical splice donor site probably null
R5061:Eya3 UTSW 4 132704378 missense probably damaging 1.00
R5411:Eya3 UTSW 4 132689779 missense probably damaging 0.99
R5479:Eya3 UTSW 4 132672933 missense possibly damaging 0.91
R6117:Eya3 UTSW 4 132711862 missense probably damaging 1.00
R6343:Eya3 UTSW 4 132672910 missense probably damaging 0.96
R6460:Eya3 UTSW 4 132680863 missense probably damaging 0.97
R7116:Eya3 UTSW 4 132694799 missense probably benign 0.00
R7418:Eya3 UTSW 4 132680848 missense possibly damaging 0.92
R7594:Eya3 UTSW 4 132694825 missense probably benign
R7624:Eya3 UTSW 4 132672951 missense probably benign 0.41
R7811:Eya3 UTSW 4 132711961 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- ATTGAGATACTAACGAGCTGAGTG -3'
(R):5'- AAAATGAGGCTGCTGCTGC -3'

Sequencing Primer
(F):5'- ATACTAACGAGCTGAGTGTTTGAG -3'
(R):5'- GTTCTTACATCCTAAGCAAACAGGG -3'
Posted On2018-05-24