Incidental Mutation 'R6443:Gm5114'
ID519086
Institutional Source Beutler Lab
Gene Symbol Gm5114
Ensembl Gene ENSMUSG00000053742
Gene Namepredicted gene 5114
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6443 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location39407294-39413160 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 39407717 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 826 (R826L)
Ref Sequence ENSEMBL: ENSMUSP00000103652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108017]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108017
AA Change: R826L

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103652
Gene: ENSMUSG00000053742
AA Change: R826L

DomainStartEndE-ValueType
Pfam:DUF4629 435 580 2.5e-65 PFAM
low complexity region 709 726 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.9%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A G 9: 4,309,357 L27P probably damaging Het
Actr6 T C 10: 89,714,871 N354D probably damaging Het
Apbb1 T A 7: 105,573,763 N214Y probably damaging Het
Bcar1 A T 8: 111,715,338 V290E probably damaging Het
Ces1f T A 8: 93,275,365 Q45L probably benign Het
Ctss A C 3: 95,546,803 K221T probably benign Het
Dclre1b T A 3: 103,803,188 N469I possibly damaging Het
Dnah12 C A 14: 26,878,051 Q3683K probably benign Het
Dnah8 A G 17: 30,771,885 I3301V probably benign Het
Ephb4 G A 5: 137,360,449 G298E probably damaging Het
Eya3 T C 4: 132,711,927 F455L probably damaging Het
Fkbp5 G T 17: 28,429,279 A112D probably damaging Het
Glud1 T C 14: 34,339,927 M468T probably benign Het
Gramd3 G A 18: 56,485,385 V222I probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Lpin2 T C 17: 71,241,668 S576P probably benign Het
Lrrc1 A G 9: 77,434,032 F415L probably damaging Het
Mtmr3 A T 11: 4,487,358 I1032K probably damaging Het
Nr5a1 G A 2: 38,710,430 T75M probably damaging Het
Nwd1 G A 8: 72,662,366 V141I possibly damaging Het
Olfr1019 T G 2: 85,841,635 D52A probably damaging Het
Olfr22-ps1 A T 11: 73,955,092 Q134L probably benign Het
Olfr807 C A 10: 129,755,408 G14V probably damaging Het
Pla1a T C 16: 38,409,587 probably null Het
Ppp1r36 A G 12: 76,417,639 S4G probably benign Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Ryr1 A T 7: 29,077,078 M2204K probably damaging Het
Ryr3 T C 2: 112,675,933 N3428S possibly damaging Het
Slc6a4 A G 11: 77,023,201 K526E probably benign Het
Slc9a8 G A 2: 167,434,821 R78H probably benign Het
Sptbn1 T C 11: 30,139,429 D611G possibly damaging Het
Sstr2 G A 11: 113,625,254 probably null Het
Tcf7 G T 11: 52,253,938 T286N probably benign Het
Txndc5 A G 13: 38,528,203 M69T possibly damaging Het
Usp48 T A 4: 137,613,763 V358E probably damaging Het
Vmn2r1 T A 3: 64,104,953 I745K possibly damaging Het
Zfp354b A G 11: 50,922,754 I448T possibly damaging Het
Zfp523 A T 17: 28,201,407 T189S probably damaging Het
Other mutations in Gm5114
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Gm5114 APN 7 39410647 splice site probably benign
IGL01295:Gm5114 APN 7 39407817 missense probably damaging 1.00
IGL01349:Gm5114 APN 7 39409107 missense probably benign
IGL01633:Gm5114 APN 7 39408066 missense probably benign
IGL01634:Gm5114 APN 7 39408647 missense probably benign
IGL02072:Gm5114 APN 7 39411402 missense probably benign 0.00
FR4304:Gm5114 UTSW 7 39411105 missense probably benign
FR4304:Gm5114 UTSW 7 39411106 missense probably benign 0.00
R0034:Gm5114 UTSW 7 39408858 missense possibly damaging 0.83
R0127:Gm5114 UTSW 7 39408456 missense probably benign 0.00
R0328:Gm5114 UTSW 7 39408461 missense probably damaging 1.00
R0387:Gm5114 UTSW 7 39408809 missense probably benign 0.15
R0693:Gm5114 UTSW 7 39408764 missense probably benign 0.00
R1006:Gm5114 UTSW 7 39409086 missense probably damaging 1.00
R2039:Gm5114 UTSW 7 39409188 missense probably damaging 1.00
R3433:Gm5114 UTSW 7 39409197 missense probably benign 0.02
R3834:Gm5114 UTSW 7 39408737 missense possibly damaging 0.69
R4320:Gm5114 UTSW 7 39407627 missense probably damaging 1.00
R5214:Gm5114 UTSW 7 39408368 missense probably benign 0.19
R5443:Gm5114 UTSW 7 39408865 missense probably benign 0.00
R5471:Gm5114 UTSW 7 39409110 nonsense probably null
R5707:Gm5114 UTSW 7 39411276 missense probably benign 0.01
R6129:Gm5114 UTSW 7 39408600 missense possibly damaging 0.71
R6234:Gm5114 UTSW 7 39409344 missense probably benign 0.19
R6326:Gm5114 UTSW 7 39408155 missense probably benign
R6530:Gm5114 UTSW 7 39408090 missense probably damaging 1.00
R6743:Gm5114 UTSW 7 39408573 missense probably benign 0.42
R6770:Gm5114 UTSW 7 39408543 missense possibly damaging 0.94
R6885:Gm5114 UTSW 7 39408156 missense probably benign 0.01
R6980:Gm5114 UTSW 7 39409200 missense probably benign 0.01
R7100:Gm5114 UTSW 7 39408284 missense possibly damaging 0.52
R7215:Gm5114 UTSW 7 39411371 missense probably benign 0.02
R7254:Gm5114 UTSW 7 39408966 missense probably benign 0.35
R7343:Gm5114 UTSW 7 39408756 missense probably damaging 1.00
R7366:Gm5114 UTSW 7 39409344 missense possibly damaging 0.69
R7474:Gm5114 UTSW 7 39407980 missense probably benign 0.01
R7499:Gm5114 UTSW 7 39409065 missense possibly damaging 0.55
R8022:Gm5114 UTSW 7 39409376 missense probably benign
R8121:Gm5114 UTSW 7 39408128 missense probably benign 0.15
R8201:Gm5114 UTSW 7 39410949 missense probably damaging 0.98
R8212:Gm5114 UTSW 7 39411252 missense probably benign 0.18
R8321:Gm5114 UTSW 7 39410849 missense possibly damaging 0.85
Z1088:Gm5114 UTSW 7 39408447 missense probably damaging 1.00
Z1177:Gm5114 UTSW 7 39409326 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTAGCCAACTTAGCATTATATGGC -3'
(R):5'- GCCAGGAACAAGGTACCATC -3'

Sequencing Primer
(F):5'- AGTCTTCTATATTCCTGCACATGTAC -3'
(R):5'- GGTACCATCACCTCCCAAACCTC -3'
Posted On2018-05-24