Incidental Mutation 'R6443:Bcar1'
ID519091
Institutional Source Beutler Lab
Gene Symbol Bcar1
Ensembl Gene ENSMUSG00000031955
Gene Namebreast cancer anti-estrogen resistance 1
Synonymsp130Cas, Cas, Crkas
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6443 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location111710474-111743809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111715338 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 290 (V290E)
Ref Sequence ENSEMBL: ENSMUSP00000148364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166232] [ENSMUST00000212349]
Predicted Effect probably damaging
Transcript: ENSMUST00000166232
AA Change: V290E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129584
Gene: ENSMUSG00000031955
AA Change: V290E

DomainStartEndE-ValueType
SH3 6 64 3e-20 SMART
low complexity region 71 92 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 353 388 N/A INTRINSIC
low complexity region 430 448 N/A INTRINSIC
Pfam:Serine_rich 458 612 9e-49 PFAM
Pfam:DUF3513 658 868 2.1e-78 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212147
Predicted Effect probably damaging
Transcript: ENSMUST00000212349
AA Change: V290E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.1351 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.9%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] BCAR1, or CAS, is an Src (MIM 190090) family kinase substrate involved in various cellular events, including migration, survival, transformation, and invasion (Sawada et al., 2006 [PubMed 17129785]).[supplied by OMIM, May 2009]
PHENOTYPE: Homozygous null embryos exhibit growth retardation and embryonic lethality, following disruption of cardiac myofibrils, increased vasodilation, and systemic congestion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A G 9: 4,309,357 L27P probably damaging Het
Actr6 T C 10: 89,714,871 N354D probably damaging Het
Apbb1 T A 7: 105,573,763 N214Y probably damaging Het
Ces1f T A 8: 93,275,365 Q45L probably benign Het
Ctss A C 3: 95,546,803 K221T probably benign Het
Dclre1b T A 3: 103,803,188 N469I possibly damaging Het
Dnah12 C A 14: 26,878,051 Q3683K probably benign Het
Dnah8 A G 17: 30,771,885 I3301V probably benign Het
Ephb4 G A 5: 137,360,449 G298E probably damaging Het
Eya3 T C 4: 132,711,927 F455L probably damaging Het
Fkbp5 G T 17: 28,429,279 A112D probably damaging Het
Glud1 T C 14: 34,339,927 M468T probably benign Het
Gm5114 C A 7: 39,407,717 R826L possibly damaging Het
Gramd3 G A 18: 56,485,385 V222I probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Lpin2 T C 17: 71,241,668 S576P probably benign Het
Lrrc1 A G 9: 77,434,032 F415L probably damaging Het
Mtmr3 A T 11: 4,487,358 I1032K probably damaging Het
Nr5a1 G A 2: 38,710,430 T75M probably damaging Het
Nwd1 G A 8: 72,662,366 V141I possibly damaging Het
Olfr1019 T G 2: 85,841,635 D52A probably damaging Het
Olfr22-ps1 A T 11: 73,955,092 Q134L probably benign Het
Olfr807 C A 10: 129,755,408 G14V probably damaging Het
Pla1a T C 16: 38,409,587 probably null Het
Ppp1r36 A G 12: 76,417,639 S4G probably benign Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Ryr1 A T 7: 29,077,078 M2204K probably damaging Het
Ryr3 T C 2: 112,675,933 N3428S possibly damaging Het
Slc6a4 A G 11: 77,023,201 K526E probably benign Het
Slc9a8 G A 2: 167,434,821 R78H probably benign Het
Sptbn1 T C 11: 30,139,429 D611G possibly damaging Het
Sstr2 G A 11: 113,625,254 probably null Het
Tcf7 G T 11: 52,253,938 T286N probably benign Het
Txndc5 A G 13: 38,528,203 M69T possibly damaging Het
Usp48 T A 4: 137,613,763 V358E probably damaging Het
Vmn2r1 T A 3: 64,104,953 I745K possibly damaging Het
Zfp354b A G 11: 50,922,754 I448T possibly damaging Het
Zfp523 A T 17: 28,201,407 T189S probably damaging Het
Other mutations in Bcar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02220:Bcar1 APN 8 111711207 missense possibly damaging 0.82
IGL02852:Bcar1 APN 8 111715347 nonsense probably null
R1914:Bcar1 UTSW 8 111715398 missense probably damaging 0.98
R1915:Bcar1 UTSW 8 111715398 missense probably damaging 0.98
R4130:Bcar1 UTSW 8 111714165 missense possibly damaging 0.47
R4249:Bcar1 UTSW 8 111720893 missense probably benign
R4437:Bcar1 UTSW 8 111715389 missense probably damaging 1.00
R4794:Bcar1 UTSW 8 111720920 nonsense probably null
R4937:Bcar1 UTSW 8 111721037 missense probably damaging 0.98
R5402:Bcar1 UTSW 8 111714330 missense probably damaging 1.00
R5951:Bcar1 UTSW 8 111713400 missense probably benign 0.02
R7595:Bcar1 UTSW 8 111720993 missense probably benign 0.01
R8313:Bcar1 UTSW 8 111713638 missense probably benign 0.01
R8373:Bcar1 UTSW 8 111715738 nonsense probably null
RF025:Bcar1 UTSW 8 111714177 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CATTGTTTGAGGCGCAGAAG -3'
(R):5'- TGCATTTTCTCAGCCTAGCCAAG -3'

Sequencing Primer
(F):5'- CCAGACACTGTATGGATGCTG -3'
(R):5'- TAGCCAAGGCCTGCGTAG -3'
Posted On2018-05-24