Incidental Mutation 'R6443:Aasdhppt'
ID519092
Institutional Source Beutler Lab
Gene Symbol Aasdhppt
Ensembl Gene ENSMUSG00000025894
Gene Nameaminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
SynonymsLYS2, 2810407B07Rik, LYS5, 2010309J24Rik, AASD-PPT, CGI-80
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.816) question?
Stock #R6443 (G1)
Quality Score177.009
Status Validated
Chromosome9
Chromosomal Location4294793-4309471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4309357 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 27 (L27P)
Ref Sequence ENSEMBL: ENSMUSP00000148272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049648] [ENSMUST00000051589] [ENSMUST00000212066] [ENSMUST00000212221] [ENSMUST00000212897]
Predicted Effect probably benign
Transcript: ENSMUST00000049648
SMART Domains Protein: ENSMUSP00000050183
Gene: ENSMUSG00000025893

DomainStartEndE-ValueType
BTB 48 145 1.83e-23 SMART
BACK 150 252 1.19e-26 SMART
Blast:Kelch 292 338 7e-15 BLAST
Kelch 339 399 2.56e0 SMART
Kelch 400 450 8.67e-4 SMART
Kelch 548 597 3.3e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000051589
AA Change: L27P

PolyPhen 2 Score 0.756 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000053971
Gene: ENSMUSG00000025894
AA Change: L27P

DomainStartEndE-ValueType
Pfam:ACPS 125 244 6e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212066
AA Change: L27P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000212221
Predicted Effect probably damaging
Transcript: ENSMUST00000212897
AA Change: L27P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.9%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to Saccharomyces cerevisiae LYS5, which is required for the activation of the alpha-aminoadipate dehydrogenase in the biosynthetic pathway of lysine. Yeast alpha-aminoadipate dehydrogenase converts alpha-biosynthetic-aminoadipate semialdehyde to alpha-aminoadipate. It has been suggested that defects in the human gene result in pipecolic acidemia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 T C 10: 89,714,871 N354D probably damaging Het
Apbb1 T A 7: 105,573,763 N214Y probably damaging Het
Bcar1 A T 8: 111,715,338 V290E probably damaging Het
Ces1f T A 8: 93,275,365 Q45L probably benign Het
Ctss A C 3: 95,546,803 K221T probably benign Het
Dclre1b T A 3: 103,803,188 N469I possibly damaging Het
Dnah12 C A 14: 26,878,051 Q3683K probably benign Het
Dnah8 A G 17: 30,771,885 I3301V probably benign Het
Ephb4 G A 5: 137,360,449 G298E probably damaging Het
Eya3 T C 4: 132,711,927 F455L probably damaging Het
Fkbp5 G T 17: 28,429,279 A112D probably damaging Het
Glud1 T C 14: 34,339,927 M468T probably benign Het
Gm5114 C A 7: 39,407,717 R826L possibly damaging Het
Gramd3 G A 18: 56,485,385 V222I probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Lpin2 T C 17: 71,241,668 S576P probably benign Het
Lrrc1 A G 9: 77,434,032 F415L probably damaging Het
Mtmr3 A T 11: 4,487,358 I1032K probably damaging Het
Nr5a1 G A 2: 38,710,430 T75M probably damaging Het
Nwd1 G A 8: 72,662,366 V141I possibly damaging Het
Olfr1019 T G 2: 85,841,635 D52A probably damaging Het
Olfr22-ps1 A T 11: 73,955,092 Q134L probably benign Het
Olfr807 C A 10: 129,755,408 G14V probably damaging Het
Pla1a T C 16: 38,409,587 probably null Het
Ppp1r36 A G 12: 76,417,639 S4G probably benign Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Ryr1 A T 7: 29,077,078 M2204K probably damaging Het
Ryr3 T C 2: 112,675,933 N3428S possibly damaging Het
Slc6a4 A G 11: 77,023,201 K526E probably benign Het
Slc9a8 G A 2: 167,434,821 R78H probably benign Het
Sptbn1 T C 11: 30,139,429 D611G possibly damaging Het
Sstr2 G A 11: 113,625,254 probably null Het
Tcf7 G T 11: 52,253,938 T286N probably benign Het
Txndc5 A G 13: 38,528,203 M69T possibly damaging Het
Usp48 T A 4: 137,613,763 V358E probably damaging Het
Vmn2r1 T A 3: 64,104,953 I745K possibly damaging Het
Zfp354b A G 11: 50,922,754 I448T possibly damaging Het
Zfp523 A T 17: 28,201,407 T189S probably damaging Het
Other mutations in Aasdhppt
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2314:Aasdhppt UTSW 9 4309322 missense probably damaging 1.00
R5406:Aasdhppt UTSW 9 4309387 missense probably damaging 1.00
R5432:Aasdhppt UTSW 9 4309349 nonsense probably null
R7935:Aasdhppt UTSW 9 4308732 missense probably benign 0.00
R8069:Aasdhppt UTSW 9 4296823 missense probably benign 0.00
R8516:Aasdhppt UTSW 9 4309373 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACTAGATGTGAGTGACCCAGGC -3'
(R):5'- CTGGTAACGTCTGTTGCGAG -3'

Sequencing Primer
(F):5'- AGGCTGAAGACGGTCGCAC -3'
(R):5'- AGGTGCTGCCCCTTTGC -3'
Posted On2018-05-24