Incidental Mutation 'R6443:Lrrc1'
ID519093
Institutional Source Beutler Lab
Gene Symbol Lrrc1
Ensembl Gene ENSMUSG00000032352
Gene Nameleucine rich repeat containing 1
SynonymsA430093J20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R6443 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location77430823-77544870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77434032 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 415 (F415L)
Ref Sequence ENSEMBL: ENSMUSP00000109048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113421] [ENSMUST00000183873]
Predicted Effect probably damaging
Transcript: ENSMUST00000113421
AA Change: F415L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109048
Gene: ENSMUSG00000032352
AA Change: F415L

DomainStartEndE-ValueType
LRR 13 35 6.57e-1 SMART
LRR 36 59 1.12e2 SMART
LRR 82 104 2.15e2 SMART
LRR 105 127 3.09e1 SMART
LRR 128 150 2.14e0 SMART
LRR 151 173 3.02e0 SMART
LRR 174 196 3.47e0 SMART
LRR 197 219 6.58e0 SMART
LRR_TYP 220 243 4.72e-2 SMART
LRR 266 289 8.97e0 SMART
LRR 313 335 1.49e2 SMART
coiled coil region 440 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183467
Predicted Effect probably damaging
Transcript: ENSMUST00000183873
AA Change: F460L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139226
Gene: ENSMUSG00000032352
AA Change: F460L

DomainStartEndE-ValueType
LRR 36 57 3.18e1 SMART
LRR 58 80 6.57e-1 SMART
LRR 81 104 1.12e2 SMART
LRR 127 149 2.15e2 SMART
LRR 150 172 3.09e1 SMART
LRR 173 195 2.14e0 SMART
LRR 196 218 3.02e0 SMART
LRR 219 241 3.47e0 SMART
LRR 242 264 6.58e0 SMART
LRR_TYP 265 288 4.72e-2 SMART
LRR 311 334 8.97e0 SMART
LRR 358 380 1.49e2 SMART
coiled coil region 485 506 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184099
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.9%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A G 9: 4,309,357 L27P probably damaging Het
Actr6 T C 10: 89,714,871 N354D probably damaging Het
Apbb1 T A 7: 105,573,763 N214Y probably damaging Het
Bcar1 A T 8: 111,715,338 V290E probably damaging Het
Ces1f T A 8: 93,275,365 Q45L probably benign Het
Ctss A C 3: 95,546,803 K221T probably benign Het
Dclre1b T A 3: 103,803,188 N469I possibly damaging Het
Dnah12 C A 14: 26,878,051 Q3683K probably benign Het
Dnah8 A G 17: 30,771,885 I3301V probably benign Het
Ephb4 G A 5: 137,360,449 G298E probably damaging Het
Eya3 T C 4: 132,711,927 F455L probably damaging Het
Fkbp5 G T 17: 28,429,279 A112D probably damaging Het
Glud1 T C 14: 34,339,927 M468T probably benign Het
Gm5114 C A 7: 39,407,717 R826L possibly damaging Het
Gramd3 G A 18: 56,485,385 V222I probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Lpin2 T C 17: 71,241,668 S576P probably benign Het
Mtmr3 A T 11: 4,487,358 I1032K probably damaging Het
Nr5a1 G A 2: 38,710,430 T75M probably damaging Het
Nwd1 G A 8: 72,662,366 V141I possibly damaging Het
Olfr1019 T G 2: 85,841,635 D52A probably damaging Het
Olfr22-ps1 A T 11: 73,955,092 Q134L probably benign Het
Olfr807 C A 10: 129,755,408 G14V probably damaging Het
Pla1a T C 16: 38,409,587 probably null Het
Ppp1r36 A G 12: 76,417,639 S4G probably benign Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Ryr1 A T 7: 29,077,078 M2204K probably damaging Het
Ryr3 T C 2: 112,675,933 N3428S possibly damaging Het
Slc6a4 A G 11: 77,023,201 K526E probably benign Het
Slc9a8 G A 2: 167,434,821 R78H probably benign Het
Sptbn1 T C 11: 30,139,429 D611G possibly damaging Het
Sstr2 G A 11: 113,625,254 probably null Het
Tcf7 G T 11: 52,253,938 T286N probably benign Het
Txndc5 A G 13: 38,528,203 M69T possibly damaging Het
Usp48 T A 4: 137,613,763 V358E probably damaging Het
Vmn2r1 T A 3: 64,104,953 I745K possibly damaging Het
Zfp354b A G 11: 50,922,754 I448T possibly damaging Het
Zfp523 A T 17: 28,201,407 T189S probably damaging Het
Other mutations in Lrrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02556:Lrrc1 APN 9 77435122 missense probably benign 0.00
IGL02975:Lrrc1 APN 9 77452647 missense probably damaging 1.00
IGL03063:Lrrc1 APN 9 77499269 missense probably damaging 0.99
R0610:Lrrc1 UTSW 9 77472206 missense possibly damaging 0.95
R1462:Lrrc1 UTSW 9 77442265 missense probably benign 0.01
R1462:Lrrc1 UTSW 9 77442265 missense probably benign 0.01
R1615:Lrrc1 UTSW 9 77435118 missense possibly damaging 0.94
R2932:Lrrc1 UTSW 9 77457439 missense probably benign 0.01
R5087:Lrrc1 UTSW 9 77457458 missense probably benign
R5907:Lrrc1 UTSW 9 77434097 missense probably damaging 0.99
R6502:Lrrc1 UTSW 9 77442191 missense probably damaging 1.00
R7073:Lrrc1 UTSW 9 77468565 missense probably benign 0.04
R7162:Lrrc1 UTSW 9 77432190 missense probably benign 0.13
R7177:Lrrc1 UTSW 9 77472222 nonsense probably null
R7290:Lrrc1 UTSW 9 77457839 missense probably benign 0.01
R7885:Lrrc1 UTSW 9 77442189 missense probably damaging 0.97
R8301:Lrrc1 UTSW 9 77544488 missense probably damaging 1.00
R8375:Lrrc1 UTSW 9 77457847 missense probably damaging 1.00
RF020:Lrrc1 UTSW 9 77452631 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCCCATTCACTTGTCATGAC -3'
(R):5'- ATGGATTCAGACCAGTCAGCC -3'

Sequencing Primer
(F):5'- GTCATGACTTATGGCTTTGAGAAC -3'
(R):5'- GTCAGCCACTAAATTACAGTGTAGC -3'
Posted On2018-05-24