Incidental Mutation 'R6443:Actr6'
ID519094
Institutional Source Beutler Lab
Gene Symbol Actr6
Ensembl Gene ENSMUSG00000019948
Gene NameARP6 actin-related protein 6
SynonymsArpX, Arp6, CDA12, 2010200J04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6443 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location89711971-89732295 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89714871 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 354 (N354D)
Ref Sequence ENSEMBL: ENSMUSP00000020109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020109]
Predicted Effect probably damaging
Transcript: ENSMUST00000020109
AA Change: N354D

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020109
Gene: ENSMUSG00000019948
AA Change: N354D

DomainStartEndE-ValueType
ACTIN 1 395 1.09e-110 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.9%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A G 9: 4,309,357 L27P probably damaging Het
Apbb1 T A 7: 105,573,763 N214Y probably damaging Het
Bcar1 A T 8: 111,715,338 V290E probably damaging Het
Ces1f T A 8: 93,275,365 Q45L probably benign Het
Ctss A C 3: 95,546,803 K221T probably benign Het
Dclre1b T A 3: 103,803,188 N469I possibly damaging Het
Dnah12 C A 14: 26,878,051 Q3683K probably benign Het
Dnah8 A G 17: 30,771,885 I3301V probably benign Het
Ephb4 G A 5: 137,360,449 G298E probably damaging Het
Eya3 T C 4: 132,711,927 F455L probably damaging Het
Fkbp5 G T 17: 28,429,279 A112D probably damaging Het
Glud1 T C 14: 34,339,927 M468T probably benign Het
Gm5114 C A 7: 39,407,717 R826L possibly damaging Het
Gramd3 G A 18: 56,485,385 V222I probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Lpin2 T C 17: 71,241,668 S576P probably benign Het
Lrrc1 A G 9: 77,434,032 F415L probably damaging Het
Mtmr3 A T 11: 4,487,358 I1032K probably damaging Het
Nr5a1 G A 2: 38,710,430 T75M probably damaging Het
Nwd1 G A 8: 72,662,366 V141I possibly damaging Het
Olfr1019 T G 2: 85,841,635 D52A probably damaging Het
Olfr22-ps1 A T 11: 73,955,092 Q134L probably benign Het
Olfr807 C A 10: 129,755,408 G14V probably damaging Het
Pla1a T C 16: 38,409,587 probably null Het
Ppp1r36 A G 12: 76,417,639 S4G probably benign Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Ryr1 A T 7: 29,077,078 M2204K probably damaging Het
Ryr3 T C 2: 112,675,933 N3428S possibly damaging Het
Slc6a4 A G 11: 77,023,201 K526E probably benign Het
Slc9a8 G A 2: 167,434,821 R78H probably benign Het
Sptbn1 T C 11: 30,139,429 D611G possibly damaging Het
Sstr2 G A 11: 113,625,254 probably null Het
Tcf7 G T 11: 52,253,938 T286N probably benign Het
Txndc5 A G 13: 38,528,203 M69T possibly damaging Het
Usp48 T A 4: 137,613,763 V358E probably damaging Het
Vmn2r1 T A 3: 64,104,953 I745K possibly damaging Het
Zfp354b A G 11: 50,922,754 I448T possibly damaging Het
Zfp523 A T 17: 28,201,407 T189S probably damaging Het
Other mutations in Actr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Actr6 APN 10 89725841 missense probably damaging 0.99
IGL01420:Actr6 APN 10 89725165 unclassified probably benign
IGL02387:Actr6 APN 10 89714984 missense probably damaging 1.00
IGL03073:Actr6 APN 10 89726694 missense probably damaging 1.00
Exalt UTSW 10 89732202 nonsense probably null
R0145:Actr6 UTSW 10 89728178 nonsense probably null
R1413:Actr6 UTSW 10 89728157 nonsense probably null
R1611:Actr6 UTSW 10 89732202 nonsense probably null
R4271:Actr6 UTSW 10 89717239 missense probably benign 0.10
R4492:Actr6 UTSW 10 89725814 missense probably benign 0.01
R4913:Actr6 UTSW 10 89714946 missense probably benign 0.09
R4976:Actr6 UTSW 10 89725855 missense probably damaging 1.00
R5119:Actr6 UTSW 10 89725855 missense probably damaging 1.00
R5767:Actr6 UTSW 10 89726755 missense probably damaging 0.99
R5946:Actr6 UTSW 10 89728192 missense probably benign 0.00
R6913:Actr6 UTSW 10 89726696 missense probably damaging 1.00
R7196:Actr6 UTSW 10 89714922 missense possibly damaging 0.89
R7201:Actr6 UTSW 10 89712512 missense probably benign 0.10
R7585:Actr6 UTSW 10 89725796 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGGCTTGGCACCTTACATG -3'
(R):5'- TGAGTCTTTCCAGAGACAAGTAG -3'

Sequencing Primer
(F):5'- GCACCTTACATGCCAGCTC -3'
(R):5'- CCAGAGACAAGTAGATTTTCTAACGC -3'
Posted On2018-05-24