Mutagenetix > Incidental Mutations

Incidental Mutation 'R6443:Mtmr3'

519096

Institutional Source

Beutler Lab

Gene Symbol

Mtmr3

Ensembl Gene

ENSMUSG00000034354

Gene Name

myotubularin related protein 3

Synonyms

FYVE-DSP1, 1700092A20Rik, ZFYVE10

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6443 (G1)

Quality Score

186.009

Status

Validated

Chromosome

Chromosomal Location

4480868-4594863 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 4487358 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 1032 (I1032K)

Ref Sequence

ENSEMBL: ENSMUSP00000137687 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040448] [ENSMUST00000109943] [ENSMUST00000123506] [ENSMUST00000128256] [ENSMUST00000130716]

Predicted Effect

probably damaging
Transcript: ENSMUST00000040448
AA Change: I1032K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000049079
Gene: ENSMUSG00000034354
AA Change: I1032K

Domain	Start	End	E-Value	Type
Pfam:Myotub-related	126	527	7.6e-149	PFAM
low complexity region	578	590	N/A	INTRINSIC
low complexity region	821	832	N/A	INTRINSIC
coiled coil region	1027	1058	N/A	INTRINSIC
FYVE	1072	1141	3.63e-31	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109943
AA Change: I1032K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000105569
Gene: ENSMUSG00000034354
AA Change: I1032K

Domain	Start	End	E-Value	Type
Pfam:Myotub-related	126	527	7.6e-149	PFAM
low complexity region	578	590	N/A	INTRINSIC
low complexity region	821	832	N/A	INTRINSIC
coiled coil region	1027	1058	N/A	INTRINSIC
FYVE	1072	1141	3.63e-31	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000123506
AA Change: I1031K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000122422
Gene: ENSMUSG00000034354
AA Change: I1031K

Domain	Start	End	E-Value	Type
Pfam:Myotub-related	126	524	1e-138	PFAM
low complexity region	577	589	N/A	INTRINSIC
low complexity region	820	831	N/A	INTRINSIC
coiled coil region	1026	1057	N/A	INTRINSIC
FYVE	1108	1177	7.77e-31	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000128256
AA Change: I1031K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000116315
Gene: ENSMUSG00000034354
AA Change: I1031K

Domain	Start	End	E-Value	Type
Pfam:Myotub-related	125	526	7.7e-149	PFAM
low complexity region	577	589	N/A	INTRINSIC
low complexity region	820	831	N/A	INTRINSIC
coiled coil region	1026	1057	N/A	INTRINSIC
FYVE	1071	1149	1.42e-24	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000130716
AA Change: I1032K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000137687
Gene: ENSMUSG00000034354
AA Change: I1032K

Domain	Start	End	E-Value	Type
Pfam:Myotub-related	126	527	2.2e-148	PFAM
low complexity region	578	590	N/A	INTRINSIC
low complexity region	821	832	N/A	INTRINSIC
coiled coil region	1027	1058	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144242

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155566

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 91.9%

Validation Efficiency

97% (37/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myotubularin dual specificity protein phosphatase gene family. The encoded protein is structurally similar to myotubularin but in addition contains a FYVE domain and an N-terminal PH-GRAM domain. The protein can self-associate and also form heteromers with another myotubularin related protein. The protein binds to phosphoinositide lipids through the PH-GRAM domain, and can hydrolyze phosphatidylinositol(3)-phosphate and phosphatidylinositol(3,5)-biphosphate in vitro. The encoded protein has been observed to have a perinuclear, possibly membrane-bound, distribution in cells, but it has also been found free in the cytoplasm. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in increased serum alkaline phosphatase level and, in males, impaired glucose tolerance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdhppt	A	G	9: 4,309,357	L27P	probably damaging	Het
Actr6	T	C	10: 89,714,871	N354D	probably damaging	Het
Apbb1	T	A	7: 105,573,763	N214Y	probably damaging	Het
Bcar1	A	T	8: 111,715,338	V290E	probably damaging	Het
Ces1f	T	A	8: 93,275,365	Q45L	probably benign	Het
Ctss	A	C	3: 95,546,803	K221T	probably benign	Het
Dclre1b	T	A	3: 103,803,188	N469I	possibly damaging	Het
Dnah12	C	A	14: 26,878,051	Q3683K	probably benign	Het
Dnah8	A	G	17: 30,771,885	I3301V	probably benign	Het
Ephb4	G	A	5: 137,360,449	G298E	probably damaging	Het
Eya3	T	C	4: 132,711,927	F455L	probably damaging	Het
Fkbp5	G	T	17: 28,429,279	A112D	probably damaging	Het
Glud1	T	C	14: 34,339,927	M468T	probably benign	Het
Gm5114	C	A	7: 39,407,717	R826L	possibly damaging	Het
Gramd3	G	A	18: 56,485,385	V222I	probably benign	Het
Kif1b	T	C	4: 149,192,596	M1337V	probably benign	Het
Lpin2	T	C	17: 71,241,668	S576P	probably benign	Het
Lrrc1	A	G	9: 77,434,032	F415L	probably damaging	Het
Nr5a1	G	A	2: 38,710,430	T75M	probably damaging	Het
Nwd1	G	A	8: 72,662,366	V141I	possibly damaging	Het
Olfr1019	T	G	2: 85,841,635	D52A	probably damaging	Het
Olfr22-ps1	A	T	11: 73,955,092	Q134L	probably benign	Het
Olfr807	C	A	10: 129,755,408	G14V	probably damaging	Het
Pla1a	T	C	16: 38,409,587		probably null	Het
Ppp1r36	A	G	12: 76,417,639	S4G	probably benign	Het
Rsf1	G	GACGGCGGCT	7: 97,579,909		probably benign	Homo
Ryr1	A	T	7: 29,077,078	M2204K	probably damaging	Het
Ryr3	T	C	2: 112,675,933	N3428S	possibly damaging	Het
Slc6a4	A	G	11: 77,023,201	K526E	probably benign	Het
Slc9a8	G	A	2: 167,434,821	R78H	probably benign	Het
Sptbn1	T	C	11: 30,139,429	D611G	possibly damaging	Het
Sstr2	G	A	11: 113,625,254		probably null	Het
Tcf7	G	T	11: 52,253,938	T286N	probably benign	Het
Txndc5	A	G	13: 38,528,203	M69T	possibly damaging	Het
Usp48	T	A	4: 137,613,763	V358E	probably damaging	Het
Vmn2r1	T	A	3: 64,104,953	I745K	possibly damaging	Het
Zfp354b	A	G	11: 50,922,754	I448T	possibly damaging	Het
Zfp523	A	T	17: 28,201,407	T189S	probably damaging	Het

Other mutations in Mtmr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01568:Mtmr3	APN	11	4527861	missense	probably damaging	1.00
IGL01808:Mtmr3	APN	11	4497404	missense	probably damaging	1.00
IGL01994:Mtmr3	APN	11	4487938	missense	probably benign
IGL02839:Mtmr3	APN	11	4487994	missense	probably benign	0.03
IGL02893:Mtmr3	APN	11	4507632	missense	possibly damaging	0.89
IGL03370:Mtmr3	APN	11	4487385	missense	probably damaging	1.00
R0322:Mtmr3	UTSW	11	4487505	missense	possibly damaging	0.59
R0363:Mtmr3	UTSW	11	4487536	missense	probably damaging	0.99
R0655:Mtmr3	UTSW	11	4488610	missense	probably damaging	1.00
R0866:Mtmr3	UTSW	11	4488474	missense	probably benign	0.03
R1065:Mtmr3	UTSW	11	4492859	missense	probably damaging	1.00
R1417:Mtmr3	UTSW	11	4487923	missense	probably benign
R1698:Mtmr3	UTSW	11	4492825	missense	possibly damaging	0.95
R1707:Mtmr3	UTSW	11	4504095	missense	probably damaging	1.00
R2191:Mtmr3	UTSW	11	4499032	missense	probably damaging	1.00
R2192:Mtmr3	UTSW	11	4499032	missense	probably damaging	1.00
R3956:Mtmr3	UTSW	11	4491138	missense	probably damaging	1.00
R4079:Mtmr3	UTSW	11	4491057	missense	probably damaging	1.00
R4320:Mtmr3	UTSW	11	4487947	missense	probably benign	0.39
R4577:Mtmr3	UTSW	11	4497375	missense	probably damaging	1.00
R4622:Mtmr3	UTSW	11	4491067	missense	possibly damaging	0.62
R4676:Mtmr3	UTSW	11	4527855	missense	probably benign	0.12
R4726:Mtmr3	UTSW	11	4507634	missense	probably damaging	1.00
R4781:Mtmr3	UTSW	11	4488435	missense	probably benign	0.00
R4799:Mtmr3	UTSW	11	4487764	missense	probably benign	0.12
R4810:Mtmr3	UTSW	11	4498046	missense	probably benign	0.33
R5744:Mtmr3	UTSW	11	4487679	missense	possibly damaging	0.47
R5847:Mtmr3	UTSW	11	4482925	missense	probably damaging	1.00
R5933:Mtmr3	UTSW	11	4498951	missense	probably benign
R6102:Mtmr3	UTSW	11	4487673	missense	probably damaging	0.99
R6105:Mtmr3	UTSW	11	4485432	missense	probably damaging	0.99
R6254:Mtmr3	UTSW	11	4497381	nonsense	probably null
R6881:Mtmr3	UTSW	11	4489725	missense	probably benign	0.33
R6941:Mtmr3	UTSW	11	4487505	missense	possibly damaging	0.59
R6986:Mtmr3	UTSW	11	4489692	missense	probably damaging	1.00
R7045:Mtmr3	UTSW	11	4498896	missense	possibly damaging	0.94
R8469:Mtmr3	UTSW	11	4531223	start codon destroyed	probably null	0.95
T0975:Mtmr3	UTSW	11	4488441	missense	probably benign
Z1176:Mtmr3	UTSW	11	4485913	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTCTGTTTCAATAACCATGCACTG -3'
(R):5'- TGTCTGCCACAAGCTGTAGC -3'

Sequencing Primer
(F):5'- CAAAGGGTTATTTTGCTGGCCTC -3'
(R):5'- GTAGCTCTGCTCACTTGTACTCGAG -3'

Posted On

2018-05-24