Incidental Mutation 'R6443:Mtmr3'
ID519096
Institutional Source Beutler Lab
Gene Symbol Mtmr3
Ensembl Gene ENSMUSG00000034354
Gene Namemyotubularin related protein 3
SynonymsFYVE-DSP1, 1700092A20Rik, ZFYVE10
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6443 (G1)
Quality Score186.009
Status Validated
Chromosome11
Chromosomal Location4480868-4594863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4487358 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 1032 (I1032K)
Ref Sequence ENSEMBL: ENSMUSP00000137687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040448] [ENSMUST00000109943] [ENSMUST00000123506] [ENSMUST00000128256] [ENSMUST00000130716]
Predicted Effect probably damaging
Transcript: ENSMUST00000040448
AA Change: I1032K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049079
Gene: ENSMUSG00000034354
AA Change: I1032K

DomainStartEndE-ValueType
Pfam:Myotub-related 126 527 7.6e-149 PFAM
low complexity region 578 590 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
coiled coil region 1027 1058 N/A INTRINSIC
FYVE 1072 1141 3.63e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109943
AA Change: I1032K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105569
Gene: ENSMUSG00000034354
AA Change: I1032K

DomainStartEndE-ValueType
Pfam:Myotub-related 126 527 7.6e-149 PFAM
low complexity region 578 590 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
coiled coil region 1027 1058 N/A INTRINSIC
FYVE 1072 1141 3.63e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123506
AA Change: I1031K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122422
Gene: ENSMUSG00000034354
AA Change: I1031K

DomainStartEndE-ValueType
Pfam:Myotub-related 126 524 1e-138 PFAM
low complexity region 577 589 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
coiled coil region 1026 1057 N/A INTRINSIC
FYVE 1108 1177 7.77e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128256
AA Change: I1031K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116315
Gene: ENSMUSG00000034354
AA Change: I1031K

DomainStartEndE-ValueType
Pfam:Myotub-related 125 526 7.7e-149 PFAM
low complexity region 577 589 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
coiled coil region 1026 1057 N/A INTRINSIC
FYVE 1071 1149 1.42e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130716
AA Change: I1032K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137687
Gene: ENSMUSG00000034354
AA Change: I1032K

DomainStartEndE-ValueType
Pfam:Myotub-related 126 527 2.2e-148 PFAM
low complexity region 578 590 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
coiled coil region 1027 1058 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155566
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.9%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myotubularin dual specificity protein phosphatase gene family. The encoded protein is structurally similar to myotubularin but in addition contains a FYVE domain and an N-terminal PH-GRAM domain. The protein can self-associate and also form heteromers with another myotubularin related protein. The protein binds to phosphoinositide lipids through the PH-GRAM domain, and can hydrolyze phosphatidylinositol(3)-phosphate and phosphatidylinositol(3,5)-biphosphate in vitro. The encoded protein has been observed to have a perinuclear, possibly membrane-bound, distribution in cells, but it has also been found free in the cytoplasm. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in increased serum alkaline phosphatase level and, in males, impaired glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A G 9: 4,309,357 L27P probably damaging Het
Actr6 T C 10: 89,714,871 N354D probably damaging Het
Apbb1 T A 7: 105,573,763 N214Y probably damaging Het
Bcar1 A T 8: 111,715,338 V290E probably damaging Het
Ces1f T A 8: 93,275,365 Q45L probably benign Het
Ctss A C 3: 95,546,803 K221T probably benign Het
Dclre1b T A 3: 103,803,188 N469I possibly damaging Het
Dnah12 C A 14: 26,878,051 Q3683K probably benign Het
Dnah8 A G 17: 30,771,885 I3301V probably benign Het
Ephb4 G A 5: 137,360,449 G298E probably damaging Het
Eya3 T C 4: 132,711,927 F455L probably damaging Het
Fkbp5 G T 17: 28,429,279 A112D probably damaging Het
Glud1 T C 14: 34,339,927 M468T probably benign Het
Gm5114 C A 7: 39,407,717 R826L possibly damaging Het
Gramd3 G A 18: 56,485,385 V222I probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Lpin2 T C 17: 71,241,668 S576P probably benign Het
Lrrc1 A G 9: 77,434,032 F415L probably damaging Het
Nr5a1 G A 2: 38,710,430 T75M probably damaging Het
Nwd1 G A 8: 72,662,366 V141I possibly damaging Het
Olfr1019 T G 2: 85,841,635 D52A probably damaging Het
Olfr22-ps1 A T 11: 73,955,092 Q134L probably benign Het
Olfr807 C A 10: 129,755,408 G14V probably damaging Het
Pla1a T C 16: 38,409,587 probably null Het
Ppp1r36 A G 12: 76,417,639 S4G probably benign Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Ryr1 A T 7: 29,077,078 M2204K probably damaging Het
Ryr3 T C 2: 112,675,933 N3428S possibly damaging Het
Slc6a4 A G 11: 77,023,201 K526E probably benign Het
Slc9a8 G A 2: 167,434,821 R78H probably benign Het
Sptbn1 T C 11: 30,139,429 D611G possibly damaging Het
Sstr2 G A 11: 113,625,254 probably null Het
Tcf7 G T 11: 52,253,938 T286N probably benign Het
Txndc5 A G 13: 38,528,203 M69T possibly damaging Het
Usp48 T A 4: 137,613,763 V358E probably damaging Het
Vmn2r1 T A 3: 64,104,953 I745K possibly damaging Het
Zfp354b A G 11: 50,922,754 I448T possibly damaging Het
Zfp523 A T 17: 28,201,407 T189S probably damaging Het
Other mutations in Mtmr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Mtmr3 APN 11 4527861 missense probably damaging 1.00
IGL01808:Mtmr3 APN 11 4497404 missense probably damaging 1.00
IGL01994:Mtmr3 APN 11 4487938 missense probably benign
IGL02839:Mtmr3 APN 11 4487994 missense probably benign 0.03
IGL02893:Mtmr3 APN 11 4507632 missense possibly damaging 0.89
IGL03370:Mtmr3 APN 11 4487385 missense probably damaging 1.00
R0322:Mtmr3 UTSW 11 4487505 missense possibly damaging 0.59
R0363:Mtmr3 UTSW 11 4487536 missense probably damaging 0.99
R0655:Mtmr3 UTSW 11 4488610 missense probably damaging 1.00
R0866:Mtmr3 UTSW 11 4488474 missense probably benign 0.03
R1065:Mtmr3 UTSW 11 4492859 missense probably damaging 1.00
R1417:Mtmr3 UTSW 11 4487923 missense probably benign
R1698:Mtmr3 UTSW 11 4492825 missense possibly damaging 0.95
R1707:Mtmr3 UTSW 11 4504095 missense probably damaging 1.00
R2191:Mtmr3 UTSW 11 4499032 missense probably damaging 1.00
R2192:Mtmr3 UTSW 11 4499032 missense probably damaging 1.00
R3956:Mtmr3 UTSW 11 4491138 missense probably damaging 1.00
R4079:Mtmr3 UTSW 11 4491057 missense probably damaging 1.00
R4320:Mtmr3 UTSW 11 4487947 missense probably benign 0.39
R4577:Mtmr3 UTSW 11 4497375 missense probably damaging 1.00
R4622:Mtmr3 UTSW 11 4491067 missense possibly damaging 0.62
R4676:Mtmr3 UTSW 11 4527855 missense probably benign 0.12
R4726:Mtmr3 UTSW 11 4507634 missense probably damaging 1.00
R4781:Mtmr3 UTSW 11 4488435 missense probably benign 0.00
R4799:Mtmr3 UTSW 11 4487764 missense probably benign 0.12
R4810:Mtmr3 UTSW 11 4498046 missense probably benign 0.33
R5744:Mtmr3 UTSW 11 4487679 missense possibly damaging 0.47
R5847:Mtmr3 UTSW 11 4482925 missense probably damaging 1.00
R5933:Mtmr3 UTSW 11 4498951 missense probably benign
R6102:Mtmr3 UTSW 11 4487673 missense probably damaging 0.99
R6105:Mtmr3 UTSW 11 4485432 missense probably damaging 0.99
R6254:Mtmr3 UTSW 11 4497381 nonsense probably null
R6881:Mtmr3 UTSW 11 4489725 missense probably benign 0.33
R6941:Mtmr3 UTSW 11 4487505 missense possibly damaging 0.59
R6986:Mtmr3 UTSW 11 4489692 missense probably damaging 1.00
R7045:Mtmr3 UTSW 11 4498896 missense possibly damaging 0.94
R8469:Mtmr3 UTSW 11 4531223 start codon destroyed probably null 0.95
T0975:Mtmr3 UTSW 11 4488441 missense probably benign
Z1176:Mtmr3 UTSW 11 4485913 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTGTTTCAATAACCATGCACTG -3'
(R):5'- TGTCTGCCACAAGCTGTAGC -3'

Sequencing Primer
(F):5'- CAAAGGGTTATTTTGCTGGCCTC -3'
(R):5'- GTAGCTCTGCTCACTTGTACTCGAG -3'
Posted On2018-05-24