Incidental Mutation 'R6443:Tcf7'
ID519099
Institutional Source Beutler Lab
Gene Symbol Tcf7
Ensembl Gene ENSMUSG00000000782
Gene Nametranscription factor 7, T cell specific
SynonymsTcf1, T-cell factor 1, T cell factor-1, TCF-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.747) question?
Stock #R6443 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location52252371-52283014 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 52253938 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 286 (T286N)
Ref Sequence ENSEMBL: ENSMUSP00000104699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086844] [ENSMUST00000109071]
Predicted Effect probably benign
Transcript: ENSMUST00000086844
AA Change: T286N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000084055
Gene: ENSMUSG00000000782
AA Change: T286N

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 100 2.2e-23 PFAM
low complexity region 119 130 N/A INTRINSIC
low complexity region 142 157 N/A INTRINSIC
HMG 187 257 2.86e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109071
AA Change: T286N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104699
Gene: ENSMUSG00000000782
AA Change: T286N

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 100 5.3e-23 PFAM
low complexity region 119 130 N/A INTRINSIC
low complexity region 142 157 N/A INTRINSIC
HMG 187 257 2.86e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181262
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.9%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: This gene encodes a transcription factor which is a member of the T-cell specific transcription factor family. The encoded protein is distinct from the hepatic transcription factor, transcription factor 1, which is also referred to by the symbol Tcf1. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice have defects in T cell development leading to decreased numbers of T cells in the periphery. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A G 9: 4,309,357 L27P probably damaging Het
Actr6 T C 10: 89,714,871 N354D probably damaging Het
Apbb1 T A 7: 105,573,763 N214Y probably damaging Het
Bcar1 A T 8: 111,715,338 V290E probably damaging Het
Ces1f T A 8: 93,275,365 Q45L probably benign Het
Ctss A C 3: 95,546,803 K221T probably benign Het
Dclre1b T A 3: 103,803,188 N469I possibly damaging Het
Dnah12 C A 14: 26,878,051 Q3683K probably benign Het
Dnah8 A G 17: 30,771,885 I3301V probably benign Het
Ephb4 G A 5: 137,360,449 G298E probably damaging Het
Eya3 T C 4: 132,711,927 F455L probably damaging Het
Fkbp5 G T 17: 28,429,279 A112D probably damaging Het
Glud1 T C 14: 34,339,927 M468T probably benign Het
Gm5114 C A 7: 39,407,717 R826L possibly damaging Het
Gramd3 G A 18: 56,485,385 V222I probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Lpin2 T C 17: 71,241,668 S576P probably benign Het
Lrrc1 A G 9: 77,434,032 F415L probably damaging Het
Mtmr3 A T 11: 4,487,358 I1032K probably damaging Het
Nr5a1 G A 2: 38,710,430 T75M probably damaging Het
Nwd1 G A 8: 72,662,366 V141I possibly damaging Het
Olfr1019 T G 2: 85,841,635 D52A probably damaging Het
Olfr22-ps1 A T 11: 73,955,092 Q134L probably benign Het
Olfr807 C A 10: 129,755,408 G14V probably damaging Het
Pla1a T C 16: 38,409,587 probably null Het
Ppp1r36 A G 12: 76,417,639 S4G probably benign Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Ryr1 A T 7: 29,077,078 M2204K probably damaging Het
Ryr3 T C 2: 112,675,933 N3428S possibly damaging Het
Slc6a4 A G 11: 77,023,201 K526E probably benign Het
Slc9a8 G A 2: 167,434,821 R78H probably benign Het
Sptbn1 T C 11: 30,139,429 D611G possibly damaging Het
Sstr2 G A 11: 113,625,254 probably null Het
Txndc5 A G 13: 38,528,203 M69T possibly damaging Het
Usp48 T A 4: 137,613,763 V358E probably damaging Het
Vmn2r1 T A 3: 64,104,953 I745K possibly damaging Het
Zfp354b A G 11: 50,922,754 I448T possibly damaging Het
Zfp523 A T 17: 28,201,407 T189S probably damaging Het
Other mutations in Tcf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01673:Tcf7 APN 11 52256996 missense probably damaging 1.00
IGL02558:Tcf7 APN 11 52253970 splice site probably benign
R1854:Tcf7 UTSW 11 52257064 missense probably benign 0.00
R2937:Tcf7 UTSW 11 52282783 splice site probably null
R2938:Tcf7 UTSW 11 52282783 splice site probably null
R3911:Tcf7 UTSW 11 52282966 start gained probably benign
R4433:Tcf7 UTSW 11 52261615 missense probably benign
R5796:Tcf7 UTSW 11 52261527 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AGCGACCTGAGAATGTTGGTG -3'
(R):5'- TTCCCCTGGAAAACAAGCAG -3'

Sequencing Primer
(F):5'- AATGTTGGTGCTGGCTCCAC -3'
(R):5'- CCCGTGTAATTGCATTTGTCCTAGG -3'
Posted On2018-05-24