Incidental Mutation 'R6443:Olfr22-ps1'
ID519100
Institutional Source Beutler Lab
Gene Symbol Olfr22-ps1
Ensembl Gene ENSMUSG00000079875
Gene Nameolfactory receptor 22, pseudogene 1
SynonymsGA_x6K02T2P1NL-4111497-4112433, MOR135-18, MTPCR35
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R6443 (G1)
Quality Score214.009
Status Validated
Chromosome11
Chromosomal Location73954692-73955628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73955092 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 134 (Q134L)
Ref Sequence ENSEMBL: ENSMUSP00000145605 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000115991
AA Change: Q134L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.9%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A G 9: 4,309,357 L27P probably damaging Het
Actr6 T C 10: 89,714,871 N354D probably damaging Het
Apbb1 T A 7: 105,573,763 N214Y probably damaging Het
Bcar1 A T 8: 111,715,338 V290E probably damaging Het
Ces1f T A 8: 93,275,365 Q45L probably benign Het
Ctss A C 3: 95,546,803 K221T probably benign Het
Dclre1b T A 3: 103,803,188 N469I possibly damaging Het
Dnah12 C A 14: 26,878,051 Q3683K probably benign Het
Dnah8 A G 17: 30,771,885 I3301V probably benign Het
Ephb4 G A 5: 137,360,449 G298E probably damaging Het
Eya3 T C 4: 132,711,927 F455L probably damaging Het
Fkbp5 G T 17: 28,429,279 A112D probably damaging Het
Glud1 T C 14: 34,339,927 M468T probably benign Het
Gm5114 C A 7: 39,407,717 R826L possibly damaging Het
Gramd3 G A 18: 56,485,385 V222I probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Lpin2 T C 17: 71,241,668 S576P probably benign Het
Lrrc1 A G 9: 77,434,032 F415L probably damaging Het
Mtmr3 A T 11: 4,487,358 I1032K probably damaging Het
Nr5a1 G A 2: 38,710,430 T75M probably damaging Het
Nwd1 G A 8: 72,662,366 V141I possibly damaging Het
Olfr1019 T G 2: 85,841,635 D52A probably damaging Het
Olfr807 C A 10: 129,755,408 G14V probably damaging Het
Pla1a T C 16: 38,409,587 probably null Het
Ppp1r36 A G 12: 76,417,639 S4G probably benign Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Ryr1 A T 7: 29,077,078 M2204K probably damaging Het
Ryr3 T C 2: 112,675,933 N3428S possibly damaging Het
Slc6a4 A G 11: 77,023,201 K526E probably benign Het
Slc9a8 G A 2: 167,434,821 R78H probably benign Het
Sptbn1 T C 11: 30,139,429 D611G possibly damaging Het
Sstr2 G A 11: 113,625,254 probably null Het
Tcf7 G T 11: 52,253,938 T286N probably benign Het
Txndc5 A G 13: 38,528,203 M69T possibly damaging Het
Usp48 T A 4: 137,613,763 V358E probably damaging Het
Vmn2r1 T A 3: 64,104,953 I745K possibly damaging Het
Zfp354b A G 11: 50,922,754 I448T possibly damaging Het
Zfp523 A T 17: 28,201,407 T189S probably damaging Het
Other mutations in Olfr22-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4997:Olfr22-ps1 UTSW 11 73954786 missense probably damaging 1.00
R7074:Olfr22-ps1 UTSW 11 73955149 missense probably benign 0.24
R7206:Olfr22-ps1 UTSW 11 73954821 missense probably benign 0.41
R7421:Olfr22-ps1 UTSW 11 73955509 missense unknown
R7554:Olfr22-ps1 UTSW 11 73954804 missense probably damaging 1.00
R7587:Olfr22-ps1 UTSW 11 73955184 nonsense probably null
R7788:Olfr22-ps1 UTSW 11 73955122 missense probably benign 0.01
Z1177:Olfr22-ps1 UTSW 11 73955113 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CACAATGCCCAAGTTGCTGC -3'
(R):5'- ATGGAAGTACGACACCAAGC -3'

Sequencing Primer
(F):5'- CAAGTTGCTGCTGAACATGC -3'
(R):5'- CCTCATTAACATGGGTGTCAGAGC -3'
Posted On2018-05-24