Incidental Mutation 'R6443:Sstr2'
ID519102
Institutional Source Beutler Lab
Gene Symbol Sstr2
Ensembl Gene ENSMUSG00000047904
Gene Namesomatostatin receptor 2
SynonymsSSTR-2, Smstr2, Smstr-2, sst2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.737) question?
Stock #R6443 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location113619342-113626028 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 113625254 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067591] [ENSMUST00000106630] [ENSMUST00000125890] [ENSMUST00000136392] [ENSMUST00000146031] [ENSMUST00000146390]
Predicted Effect probably null
Transcript: ENSMUST00000067591
SMART Domains Protein: ENSMUSP00000068578
Gene: ENSMUSG00000047904

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 51 281 1.1e-10 PFAM
Pfam:7TM_GPCR_Srsx 54 327 1.9e-20 PFAM
Pfam:7tm_1 60 312 2.5e-70 PFAM
Pfam:7TM_GPCR_Srv 118 329 4.9e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106630
SMART Domains Protein: ENSMUSP00000102241
Gene: ENSMUSG00000047904

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 51 284 1.3e-10 PFAM
Pfam:7TM_GPCR_Srsx 54 327 1.9e-20 PFAM
Pfam:7tm_1 60 312 1.4e-65 PFAM
Pfam:7TM_GPCR_Srv 119 328 4.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123153
Predicted Effect probably benign
Transcript: ENSMUST00000125890
SMART Domains Protein: ENSMUSP00000115472
Gene: ENSMUSG00000041654

DomainStartEndE-ValueType
Pfam:Zip 7 200 3.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136392
Predicted Effect probably benign
Transcript: ENSMUST00000146031
SMART Domains Protein: ENSMUSP00000121286
Gene: ENSMUSG00000041654

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146390
AA Change: S333N

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000138101
Gene: ENSMUSG00000047904
AA Change: S333N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 51 284 1.8e-10 PFAM
Pfam:7TM_GPCR_Srsx 54 327 2.4e-20 PFAM
Pfam:7tm_1 60 312 3.1e-70 PFAM
Pfam:7TM_GPCR_Srv 118 329 5.7e-13 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.9%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: The protein encoded by this gene is a receptor for somatostatin, which acts at many sites to inhibit the release of several hormones and other secretory proteins. The encoded protein is a member of the superfamily of receptors having seven transmembrane segments and is involved in many processes, including adenylyl cyclase inhibition, phosphotyrosine phosphatase stimulation, and inhibition of calcium entry and cell growth. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a null allele show elevated anxiety and locomotor and exploratory deficits. Homozygotes for a reporter allele show altered motor coordination, somatostatin-induced dopamine and glutamate release, retinal rod bipolar cells and EEG patterns, and reduced infarction after focal ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A G 9: 4,309,357 L27P probably damaging Het
Actr6 T C 10: 89,714,871 N354D probably damaging Het
Apbb1 T A 7: 105,573,763 N214Y probably damaging Het
Bcar1 A T 8: 111,715,338 V290E probably damaging Het
Ces1f T A 8: 93,275,365 Q45L probably benign Het
Ctss A C 3: 95,546,803 K221T probably benign Het
Dclre1b T A 3: 103,803,188 N469I possibly damaging Het
Dnah12 C A 14: 26,878,051 Q3683K probably benign Het
Dnah8 A G 17: 30,771,885 I3301V probably benign Het
Ephb4 G A 5: 137,360,449 G298E probably damaging Het
Eya3 T C 4: 132,711,927 F455L probably damaging Het
Fkbp5 G T 17: 28,429,279 A112D probably damaging Het
Glud1 T C 14: 34,339,927 M468T probably benign Het
Gm5114 C A 7: 39,407,717 R826L possibly damaging Het
Gramd3 G A 18: 56,485,385 V222I probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Lpin2 T C 17: 71,241,668 S576P probably benign Het
Lrrc1 A G 9: 77,434,032 F415L probably damaging Het
Mtmr3 A T 11: 4,487,358 I1032K probably damaging Het
Nr5a1 G A 2: 38,710,430 T75M probably damaging Het
Nwd1 G A 8: 72,662,366 V141I possibly damaging Het
Olfr1019 T G 2: 85,841,635 D52A probably damaging Het
Olfr22-ps1 A T 11: 73,955,092 Q134L probably benign Het
Olfr807 C A 10: 129,755,408 G14V probably damaging Het
Pla1a T C 16: 38,409,587 probably null Het
Ppp1r36 A G 12: 76,417,639 S4G probably benign Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Ryr1 A T 7: 29,077,078 M2204K probably damaging Het
Ryr3 T C 2: 112,675,933 N3428S possibly damaging Het
Slc6a4 A G 11: 77,023,201 K526E probably benign Het
Slc9a8 G A 2: 167,434,821 R78H probably benign Het
Sptbn1 T C 11: 30,139,429 D611G possibly damaging Het
Tcf7 G T 11: 52,253,938 T286N probably benign Het
Txndc5 A G 13: 38,528,203 M69T possibly damaging Het
Usp48 T A 4: 137,613,763 V358E probably damaging Het
Vmn2r1 T A 3: 64,104,953 I745K possibly damaging Het
Zfp354b A G 11: 50,922,754 I448T possibly damaging Het
Zfp523 A T 17: 28,201,407 T189S probably damaging Het
Other mutations in Sstr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Sstr2 APN 11 113624995 missense probably benign 0.22
IGL01555:Sstr2 APN 11 113625619 missense probably benign 0.32
IGL02173:Sstr2 APN 11 113625016 missense probably damaging 1.00
IGL02430:Sstr2 APN 11 113624804 missense probably damaging 0.99
chat UTSW 11 113624549 missense probably damaging 1.00
R0125:Sstr2 UTSW 11 113624477 missense probably damaging 1.00
R0565:Sstr2 UTSW 11 113625619 missense probably benign 0.32
R1227:Sstr2 UTSW 11 113624885 missense probably damaging 0.99
R1356:Sstr2 UTSW 11 113624894 missense probably damaging 1.00
R1992:Sstr2 UTSW 11 113624669 missense probably benign 0.03
R2504:Sstr2 UTSW 11 113624431 missense probably damaging 0.98
R2509:Sstr2 UTSW 11 113624923 missense probably damaging 0.99
R2510:Sstr2 UTSW 11 113624923 missense probably damaging 0.99
R2511:Sstr2 UTSW 11 113624923 missense probably damaging 0.99
R4051:Sstr2 UTSW 11 113624656 missense probably damaging 1.00
R4083:Sstr2 UTSW 11 113625245 missense probably benign 0.05
R4207:Sstr2 UTSW 11 113624656 missense probably damaging 1.00
R4208:Sstr2 UTSW 11 113624656 missense probably damaging 1.00
R5666:Sstr2 UTSW 11 113624713 missense probably damaging 1.00
R6264:Sstr2 UTSW 11 113625106 missense probably damaging 1.00
R6339:Sstr2 UTSW 11 113624549 missense probably damaging 1.00
R6968:Sstr2 UTSW 11 113624948 missense probably damaging 1.00
R7146:Sstr2 UTSW 11 113625353 missense probably damaging 1.00
R7735:Sstr2 UTSW 11 113624597 missense possibly damaging 0.75
R8057:Sstr2 UTSW 11 113624273 missense probably benign
R8086:Sstr2 UTSW 11 113625172 missense probably damaging 1.00
R8087:Sstr2 UTSW 11 113624675 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCCATCGTAGTGGCTGTC -3'
(R):5'- TCTAGAAGCCGGGTGTGATG -3'

Sequencing Primer
(F):5'- ATCGTAGTGGCTGTCTTCATC -3'
(R):5'- CTAGAAGCCGGGTGTGATGGATAG -3'
Posted On2018-05-24