Mutagenetix > Incidental Mutations

Incidental Mutation 'R6443:Sstr2'

519102

Institutional Source

Beutler Lab

Gene Symbol

Sstr2

Ensembl Gene

ENSMUSG00000047904

Gene Name

somatostatin receptor 2

Synonyms

SSTR-2, Smstr2, Smstr-2, sst2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.672) question?

Stock #

R6443 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

113619342-113626028 bp(+) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

G to A at 113625254 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000102241 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067591] [ENSMUST00000106630] [ENSMUST00000125890] [ENSMUST00000136392] [ENSMUST00000146031] [ENSMUST00000146390]

AlphaFold

P30875

Predicted Effect

probably null
Transcript: ENSMUST00000067591

SMART Domains

Protein: ENSMUSP00000068578
Gene: ENSMUSG00000047904

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srx	51	281	1.1e-10	PFAM
Pfam:7TM_GPCR_Srsx	54	327	1.9e-20	PFAM
Pfam:7tm_1	60	312	2.5e-70	PFAM
Pfam:7TM_GPCR_Srv	118	329	4.9e-13	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000106630

SMART Domains

Protein: ENSMUSP00000102241
Gene: ENSMUSG00000047904

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srx	51	284	1.3e-10	PFAM
Pfam:7TM_GPCR_Srsx	54	327	1.9e-20	PFAM
Pfam:7tm_1	60	312	1.4e-65	PFAM
Pfam:7TM_GPCR_Srv	119	328	4.3e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123153

Predicted Effect

probably benign
Transcript: ENSMUST00000125890

SMART Domains

Protein: ENSMUSP00000115472
Gene: ENSMUSG00000041654

Domain	Start	End	E-Value	Type
Pfam:Zip	7	200	3.6e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000136392

Predicted Effect

probably benign
Transcript: ENSMUST00000146031

SMART Domains

Protein: ENSMUSP00000121286
Gene: ENSMUSG00000041654

Domain	Start	End	E-Value	Type
transmembrane domain	10	32	N/A	INTRINSIC
transmembrane domain	39	61	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000146390
AA Change: S333N

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000138101
Gene: ENSMUSG00000047904
AA Change: S333N

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srx	51	284	1.8e-10	PFAM
Pfam:7TM_GPCR_Srsx	54	327	2.4e-20	PFAM
Pfam:7tm_1	60	312	3.1e-70	PFAM
Pfam:7TM_GPCR_Srv	118	329	5.7e-13	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 91.9%

Validation Efficiency

97% (37/38)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a receptor for somatostatin, which acts at many sites to inhibit the release of several hormones and other secretory proteins. The encoded protein is a member of the superfamily of receptors having seven transmembrane segments and is involved in many processes, including adenylyl cyclase inhibition, phosphotyrosine phosphatase stimulation, and inhibition of calcium entry and cell growth. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a null allele show elevated anxiety and locomotor and exploratory deficits. Homozygotes for a reporter allele show altered motor coordination, somatostatin-induced dopamine and glutamate release, retinal rod bipolar cells and EEG patterns, and reduced infarction after focal ischemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdhppt	A	G	9: 4,309,357	L27P	probably damaging	Het
Actr6	T	C	10: 89,714,871	N354D	probably damaging	Het
Apbb1	T	A	7: 105,573,763	N214Y	probably damaging	Het
Bcar1	A	T	8: 111,715,338	V290E	probably damaging	Het
Ces1f	T	A	8: 93,275,365	Q45L	probably benign	Het
Ctss	A	C	3: 95,546,803	K221T	probably benign	Het
Dclre1b	T	A	3: 103,803,188	N469I	possibly damaging	Het
Dnah12	C	A	14: 26,878,051	Q3683K	probably benign	Het
Dnah8	A	G	17: 30,771,885	I3301V	probably benign	Het
Ephb4	G	A	5: 137,360,449	G298E	probably damaging	Het
Eya3	T	C	4: 132,711,927	F455L	probably damaging	Het
Fkbp5	G	T	17: 28,429,279	A112D	probably damaging	Het
Glud1	T	C	14: 34,339,927	M468T	probably benign	Het
Gm5114	C	A	7: 39,407,717	R826L	possibly damaging	Het
Gramd3	G	A	18: 56,485,385	V222I	probably benign	Het
Kif1b	T	C	4: 149,192,596	M1337V	probably benign	Het
Lpin2	T	C	17: 71,241,668	S576P	probably benign	Het
Lrrc1	A	G	9: 77,434,032	F415L	probably damaging	Het
Mtmr3	A	T	11: 4,487,358	I1032K	probably damaging	Het
Nr5a1	G	A	2: 38,710,430	T75M	probably damaging	Het
Nwd1	G	A	8: 72,662,366	V141I	possibly damaging	Het
Olfr1019	T	G	2: 85,841,635	D52A	probably damaging	Het
Olfr22-ps1	A	T	11: 73,955,092	Q134L	probably benign	Het
Olfr807	C	A	10: 129,755,408	G14V	probably damaging	Het
Pla1a	T	C	16: 38,409,587		probably null	Het
Ppp1r36	A	G	12: 76,417,639	S4G	probably benign	Het
Rsf1	G	GACGGCGGCT	7: 97,579,909		probably benign	Homo
Ryr1	A	T	7: 29,077,078	M2204K	probably damaging	Het
Ryr3	T	C	2: 112,675,933	N3428S	possibly damaging	Het
Slc6a4	A	G	11: 77,023,201	K526E	probably benign	Het
Slc9a8	G	A	2: 167,434,821	R78H	probably benign	Het
Sptbn1	T	C	11: 30,139,429	D611G	possibly damaging	Het
Tcf7	G	T	11: 52,253,938	T286N	probably benign	Het
Txndc5	A	G	13: 38,528,203	M69T	possibly damaging	Het
Usp48	T	A	4: 137,613,763	V358E	probably damaging	Het
Vmn2r1	T	A	3: 64,104,953	I745K	possibly damaging	Het
Zfp354b	A	G	11: 50,922,754	I448T	possibly damaging	Het
Zfp523	A	T	17: 28,201,407	T189S	probably damaging	Het

Other mutations in Sstr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00906:Sstr2	APN	11	113624995	missense	probably benign	0.22
IGL01555:Sstr2	APN	11	113625619	missense	probably benign	0.32
IGL02173:Sstr2	APN	11	113625016	missense	probably damaging	1.00
IGL02430:Sstr2	APN	11	113624804	missense	probably damaging	0.99
chat	UTSW	11	113624549	missense	probably damaging	1.00
R0125:Sstr2	UTSW	11	113624477	missense	probably damaging	1.00
R0565:Sstr2	UTSW	11	113625619	missense	probably benign	0.32
R1227:Sstr2	UTSW	11	113624885	missense	probably damaging	0.99
R1356:Sstr2	UTSW	11	113624894	missense	probably damaging	1.00
R1992:Sstr2	UTSW	11	113624669	missense	probably benign	0.03
R2504:Sstr2	UTSW	11	113624431	missense	probably damaging	0.98
R2509:Sstr2	UTSW	11	113624923	missense	probably damaging	0.99
R2510:Sstr2	UTSW	11	113624923	missense	probably damaging	0.99
R2511:Sstr2	UTSW	11	113624923	missense	probably damaging	0.99
R4051:Sstr2	UTSW	11	113624656	missense	probably damaging	1.00
R4083:Sstr2	UTSW	11	113625245	missense	probably benign	0.05
R4207:Sstr2	UTSW	11	113624656	missense	probably damaging	1.00
R4208:Sstr2	UTSW	11	113624656	missense	probably damaging	1.00
R5666:Sstr2	UTSW	11	113624713	missense	probably damaging	1.00
R6264:Sstr2	UTSW	11	113625106	missense	probably damaging	1.00
R6339:Sstr2	UTSW	11	113624549	missense	probably damaging	1.00
R6968:Sstr2	UTSW	11	113624948	missense	probably damaging	1.00
R7146:Sstr2	UTSW	11	113625353	missense	probably damaging	1.00
R7735:Sstr2	UTSW	11	113624597	missense	possibly damaging	0.75
R8057:Sstr2	UTSW	11	113624273	missense	probably benign
R8086:Sstr2	UTSW	11	113625172	missense	probably damaging	1.00
R8087:Sstr2	UTSW	11	113624675	missense	probably damaging	1.00
R9076:Sstr2	UTSW	11	113624351	missense	probably benign	0.00
R9194:Sstr2	UTSW	11	113624377	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TGTCCATCGTAGTGGCTGTC -3'
(R):5'- TCTAGAAGCCGGGTGTGATG -3'

Sequencing Primer
(F):5'- ATCGTAGTGGCTGTCTTCATC -3'
(R):5'- CTAGAAGCCGGGTGTGATGGATAG -3'

Posted On

2018-05-24