Incidental Mutation 'R6443:Zfp523'
ID519108
Institutional Source Beutler Lab
Gene Symbol Zfp523
Ensembl Gene ENSMUSG00000024220
Gene Namezinc finger protein 523
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.411) question?
Stock #R6443 (G1)
Quality Score142.008
Status Validated
Chromosome17
Chromosomal Location28177207-28205886 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28201407 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 189 (T189S)
Ref Sequence ENSEMBL: ENSMUSP00000123127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002318] [ENSMUST00000073534] [ENSMUST00000133868] [ENSMUST00000155030]
Predicted Effect probably damaging
Transcript: ENSMUST00000002318
AA Change: T300S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000002318
Gene: ENSMUSG00000024220
AA Change: T300S

DomainStartEndE-ValueType
internal_repeat_1 7 45 7.42e-6 PROSPERO
internal_repeat_1 60 99 7.42e-6 PROSPERO
low complexity region 116 129 N/A INTRINSIC
ZnF_C2H2 165 189 7.15e-2 SMART
ZnF_C2H2 195 219 3.16e-3 SMART
ZnF_C2H2 225 249 8.47e-4 SMART
ZnF_C2H2 255 279 2.24e-3 SMART
ZnF_C2H2 285 309 3.44e-4 SMART
ZnF_C2H2 315 339 1.69e-3 SMART
ZnF_C2H2 345 368 5.06e-2 SMART
low complexity region 375 396 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000073534
AA Change: T300S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073226
Gene: ENSMUSG00000024220
AA Change: T300S

DomainStartEndE-ValueType
internal_repeat_1 7 45 7.42e-6 PROSPERO
internal_repeat_1 60 99 7.42e-6 PROSPERO
low complexity region 116 129 N/A INTRINSIC
ZnF_C2H2 165 189 7.15e-2 SMART
ZnF_C2H2 195 219 3.16e-3 SMART
ZnF_C2H2 225 249 8.47e-4 SMART
ZnF_C2H2 255 279 2.24e-3 SMART
ZnF_C2H2 285 309 3.44e-4 SMART
ZnF_C2H2 315 339 1.69e-3 SMART
ZnF_C2H2 345 368 5.06e-2 SMART
low complexity region 375 396 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129522
Predicted Effect probably damaging
Transcript: ENSMUST00000133868
AA Change: T189S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123127
Gene: ENSMUSG00000024220
AA Change: T189S

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
ZnF_C2H2 84 108 7.15e-2 SMART
ZnF_C2H2 114 138 3.16e-3 SMART
ZnF_C2H2 144 168 8.47e-4 SMART
ZnF_C2H2 174 198 3.44e-4 SMART
ZnF_C2H2 204 228 1.69e-3 SMART
ZnF_C2H2 234 257 5.06e-2 SMART
low complexity region 264 285 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151595
Predicted Effect probably benign
Transcript: ENSMUST00000155030
SMART Domains Protein: ENSMUSP00000117730
Gene: ENSMUSG00000024220

DomainStartEndE-ValueType
low complexity region 18 35 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161275
Meta Mutation Damage Score 0.3383 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.9%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A G 9: 4,309,357 L27P probably damaging Het
Actr6 T C 10: 89,714,871 N354D probably damaging Het
Apbb1 T A 7: 105,573,763 N214Y probably damaging Het
Bcar1 A T 8: 111,715,338 V290E probably damaging Het
Ces1f T A 8: 93,275,365 Q45L probably benign Het
Ctss A C 3: 95,546,803 K221T probably benign Het
Dclre1b T A 3: 103,803,188 N469I possibly damaging Het
Dnah12 C A 14: 26,878,051 Q3683K probably benign Het
Dnah8 A G 17: 30,771,885 I3301V probably benign Het
Ephb4 G A 5: 137,360,449 G298E probably damaging Het
Eya3 T C 4: 132,711,927 F455L probably damaging Het
Fkbp5 G T 17: 28,429,279 A112D probably damaging Het
Glud1 T C 14: 34,339,927 M468T probably benign Het
Gm5114 C A 7: 39,407,717 R826L possibly damaging Het
Gramd3 G A 18: 56,485,385 V222I probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Lpin2 T C 17: 71,241,668 S576P probably benign Het
Lrrc1 A G 9: 77,434,032 F415L probably damaging Het
Mtmr3 A T 11: 4,487,358 I1032K probably damaging Het
Nr5a1 G A 2: 38,710,430 T75M probably damaging Het
Nwd1 G A 8: 72,662,366 V141I possibly damaging Het
Olfr1019 T G 2: 85,841,635 D52A probably damaging Het
Olfr22-ps1 A T 11: 73,955,092 Q134L probably benign Het
Olfr807 C A 10: 129,755,408 G14V probably damaging Het
Pla1a T C 16: 38,409,587 probably null Het
Ppp1r36 A G 12: 76,417,639 S4G probably benign Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Ryr1 A T 7: 29,077,078 M2204K probably damaging Het
Ryr3 T C 2: 112,675,933 N3428S possibly damaging Het
Slc6a4 A G 11: 77,023,201 K526E probably benign Het
Slc9a8 G A 2: 167,434,821 R78H probably benign Het
Sptbn1 T C 11: 30,139,429 D611G possibly damaging Het
Sstr2 G A 11: 113,625,254 probably null Het
Tcf7 G T 11: 52,253,938 T286N probably benign Het
Txndc5 A G 13: 38,528,203 M69T possibly damaging Het
Usp48 T A 4: 137,613,763 V358E probably damaging Het
Vmn2r1 T A 3: 64,104,953 I745K possibly damaging Het
Zfp354b A G 11: 50,922,754 I448T possibly damaging Het
Other mutations in Zfp523
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Zfp523 APN 17 28201049 missense possibly damaging 0.95
IGL01405:Zfp523 APN 17 28204506 missense probably damaging 0.99
IGL02430:Zfp523 APN 17 28195139 unclassified probably benign
R0496:Zfp523 UTSW 17 28200445 missense possibly damaging 0.83
R1533:Zfp523 UTSW 17 28204499 missense probably benign 0.18
R1837:Zfp523 UTSW 17 28194993 missense probably damaging 0.99
R1838:Zfp523 UTSW 17 28194993 missense probably damaging 0.99
R1839:Zfp523 UTSW 17 28194993 missense probably damaging 0.99
R2023:Zfp523 UTSW 17 28201004 unclassified probably benign
R2104:Zfp523 UTSW 17 28195216 missense probably benign 0.31
R2403:Zfp523 UTSW 17 28195209 missense probably damaging 1.00
R2864:Zfp523 UTSW 17 28202540 missense probably benign 0.00
R4157:Zfp523 UTSW 17 28202283 missense probably benign 0.06
R4214:Zfp523 UTSW 17 28201029 missense probably benign 0.04
R4771:Zfp523 UTSW 17 28201338 splice site probably null
R5869:Zfp523 UTSW 17 28194993 missense probably benign 0.37
R5950:Zfp523 UTSW 17 28202558 missense probably benign 0.06
R6679:Zfp523 UTSW 17 28202220 missense probably damaging 1.00
R6694:Zfp523 UTSW 17 28200472 missense probably damaging 1.00
R7669:Zfp523 UTSW 17 28201041 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGATTGAGGCCCAGAGC -3'
(R):5'- GTGAGACAGCATTTGGGGTAC -3'

Sequencing Primer
(F):5'- AGAGCTGTCCTTTCTTGCTCTGG -3'
(R):5'- GTACCCACCCCTGCCCAG -3'
Posted On2018-05-24