Mutagenetix > Incidental Mutations

Incidental Mutation 'R6444:Eif5b'

519114

Institutional Source

Beutler Lab

Gene Symbol

Eif5b

Ensembl Gene

ENSMUSG00000026083

Gene Name

eukaryotic translation initiation factor 5B

Synonyms

A030003E17Rik, IF2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6444 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

37998010-38055579 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 38036211 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 590 (D590N)

Ref Sequence

ENSEMBL: ENSMUSP00000027252 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027252]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027252
AA Change: D590N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000027252
Gene: ENSMUSG00000026083
AA Change: D590N

Domain	Start	End	E-Value	Type
low complexity region	19	32	N/A	INTRINSIC
low complexity region	33	51	N/A	INTRINSIC
low complexity region	94	106	N/A	INTRINSIC
low complexity region	110	126	N/A	INTRINSIC
low complexity region	145	161	N/A	INTRINSIC
low complexity region	183	193	N/A	INTRINSIC
coiled coil region	227	272	N/A	INTRINSIC
coiled coil region	301	414	N/A	INTRINSIC
low complexity region	480	498	N/A	INTRINSIC
coiled coil region	523	554	N/A	INTRINSIC
low complexity region	580	594	N/A	INTRINSIC
Pfam:GTP_EFTU	625	840	4.7e-35	PFAM
Pfam:MMR_HSR1	629	753	5.1e-6	PFAM
Pfam:GTP_EFTU_D2	866	944	7.1e-11	PFAM
Pfam:IF-2	959	1066	1.4e-20	PFAM
Blast:S1	1116	1172	2e-6	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192548

Meta Mutation Damage Score

0.1086

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Accurate initiation of translation in eukaryotes is complex and requires many factors, some of which are composed of multiple subunits. The process is simpler in prokaryotes which have only three initiation factors (IF1, IF2, IF3). Two of these factors are conserved in eukaryotes: the homolog of IF1 is eIF1A and the homolog of IF2 is eIF5B. This gene encodes eIF5B. Factors eIF1A and eIF5B interact on the ribosome along with other initiation factors and GTP to position the initiation methionine tRNA on the start codon of the mRNA so that translation initiates accurately. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430033K04Rik	ACAGAGCAGTGCCTACCAG	ACAG	5: 138,639,569		probably benign	Het
Bcas2	T	A	3: 103,172,046		probably null	Het
Camk1d	A	T	2: 5,313,145	I233N	probably damaging	Het
Chd2	T	C	7: 73,501,037		probably null	Het
Cnot2	T	C	10: 116,499,355	D246G	probably benign	Het
Cped1	A	C	6: 21,986,931	I41L	probably benign	Het
Dcdc2c	A	G	12: 28,535,476	V174A	probably damaging	Het
Dscam	G	A	16: 96,619,644	R1681C	probably damaging	Het
Dysf	G	A	6: 84,190,840	V1755M	probably benign	Het
Fntb	A	G	12: 76,916,440	Y399C	probably damaging	Het
Galns	T	C	8: 122,611,338	M1V	probably null	Het
Galnt15	T	C	14: 32,040,411	F199L	probably damaging	Het
Gm8229	A	T	14: 44,365,471	H38L	unknown	Het
Magel2	T	C	7: 62,379,999	Y884H	unknown	Het
Miga1	A	T	3: 152,283,831	V473E	probably damaging	Het
Mrgprx1	C	T	7: 48,021,814	V62I	possibly damaging	Het
Mybl1	G	A	1: 9,685,692	P211S	possibly damaging	Het
Myo19	A	G	11: 84,895,308	H254R	probably benign	Het
Myo1h	A	G	5: 114,314,956	T6A	possibly damaging	Het
Ncbp2	CGTCTGGATG	CG	16: 31,956,343		probably null	Het
Olfr1475	A	T	19: 13,479,430	M256K	possibly damaging	Het
Olfr44	T	C	9: 39,484,318	T309A	probably benign	Het
Psmd12	A	G	11: 107,486,454	E113G	possibly damaging	Het
Ptpn3	T	C	4: 57,195,730	D879G	possibly damaging	Het
Rufy3	A	G	5: 88,637,307	Q414R	probably damaging	Het
Slc14a2	A	G	18: 78,154,102	I813T	probably damaging	Het
Smok2a	G	T	17: 13,225,613	A26S	probably benign	Het
Spsb3	T	A	17: 24,891,576	L459Q	probably damaging	Het
Tacc2	T	C	7: 130,623,412	V609A	possibly damaging	Het
Tmem185b	C	A	1: 119,526,635	A42E	probably damaging	Het
Trim56	A	G	5: 137,112,616	V682A	probably damaging	Het
Trim75	T	C	8: 64,982,836	K321E	possibly damaging	Het
Ttc17	A	C	2: 94,303,546	M1098R	possibly damaging	Het
Ydjc	C	A	16: 17,147,681	H136Q	probably damaging	Het
Zfp568	A	T	7: 30,017,257	H193L	probably benign	Het
Znhit1	A	G	5: 136,982,400	V153A	probably benign	Het

Other mutations in Eif5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Eif5b	APN	1	38041719	missense	probably damaging	1.00
IGL01377:Eif5b	APN	1	38036098	missense	probably benign
IGL01395:Eif5b	APN	1	38037258	missense	probably damaging	0.96
IGL01572:Eif5b	APN	1	38022254	nonsense	probably null
IGL01615:Eif5b	APN	1	38045706	missense	probably damaging	1.00
IGL02141:Eif5b	APN	1	38032322	missense	probably benign	0.09
IGL02260:Eif5b	APN	1	38045456	missense	possibly damaging	0.81
IGL02308:Eif5b	APN	1	38041747	missense	probably damaging	1.00
IGL03180:Eif5b	APN	1	38036269	missense	probably damaging	1.00
IGL03327:Eif5b	APN	1	38041691	splice site	probably benign
R0018:Eif5b	UTSW	1	38018889	missense	unknown
R0036:Eif5b	UTSW	1	38019111	missense	probably benign	0.23
R0137:Eif5b	UTSW	1	38019243	missense	probably benign	0.23
R0349:Eif5b	UTSW	1	38032366	missense	probably benign	0.18
R0606:Eif5b	UTSW	1	38048893	missense	probably damaging	1.00
R1056:Eif5b	UTSW	1	38022167	missense	unknown
R1225:Eif5b	UTSW	1	38037628	missense	probably damaging	1.00
R2043:Eif5b	UTSW	1	38041819	missense	probably damaging	1.00
R2163:Eif5b	UTSW	1	38048794	missense	probably benign	0.32
R2225:Eif5b	UTSW	1	38019223	missense	unknown
R2432:Eif5b	UTSW	1	38019342	missense	unknown
R2922:Eif5b	UTSW	1	38018019	splice site	probably benign
R4357:Eif5b	UTSW	1	38050258	missense	probably damaging	1.00
R4631:Eif5b	UTSW	1	38041747	missense	probably damaging	1.00
R4665:Eif5b	UTSW	1	38045712	missense	probably damaging	1.00
R4702:Eif5b	UTSW	1	38018877	missense	unknown
R4941:Eif5b	UTSW	1	38051199	missense	probably damaging	1.00
R4995:Eif5b	UTSW	1	38051711	makesense	probably null
R5020:Eif5b	UTSW	1	38019069	nonsense	probably null
R5175:Eif5b	UTSW	1	38045387	missense	probably damaging	1.00
R5375:Eif5b	UTSW	1	38045754	missense	possibly damaging	0.66
R5566:Eif5b	UTSW	1	38045684	missense	possibly damaging	0.90
R5566:Eif5b	UTSW	1	38051247	missense	probably damaging	1.00
R5853:Eif5b	UTSW	1	38037307	missense	probably damaging	1.00
R5978:Eif5b	UTSW	1	37998280	unclassified	probably null
R6315:Eif5b	UTSW	1	38018033	missense	unknown
R6376:Eif5b	UTSW	1	38045679	missense	probably damaging	0.98
R6388:Eif5b	UTSW	1	38019000	missense	unknown
R6455:Eif5b	UTSW	1	38019027	missense	probably benign	0.23
R6810:Eif5b	UTSW	1	38046660	missense	probably benign	0.45
R6877:Eif5b	UTSW	1	38050239	missense	probably damaging	1.00
R7130:Eif5b	UTSW	1	38041776	missense	probably damaging	1.00
R7180:Eif5b	UTSW	1	38049074	missense	probably damaging	0.98
R7439:Eif5b	UTSW	1	38051637	missense	probably benign	0.28
R7488:Eif5b	UTSW	1	38050306	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- AGGGCGACTGCTGTAATTAGTG -3'
(R):5'- ACACAGCTTGGTCCAACATTAC -3'

Sequencing Primer
(F):5'- GCGACTGCTGTAATTAGTGTAATTTC -3'
(R):5'- GCTTGGTCCAACATTACAAAAACTGG -3'

Posted On

2018-05-24