Incidental Mutation 'R6444:Eif5b'
ID519114
Institutional Source Beutler Lab
Gene Symbol Eif5b
Ensembl Gene ENSMUSG00000026083
Gene Nameeukaryotic translation initiation factor 5B
SynonymsA030003E17Rik, IF2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6444 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location37998010-38055579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38036211 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 590 (D590N)
Ref Sequence ENSEMBL: ENSMUSP00000027252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027252]
Predicted Effect probably damaging
Transcript: ENSMUST00000027252
AA Change: D590N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027252
Gene: ENSMUSG00000026083
AA Change: D590N

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
low complexity region 33 51 N/A INTRINSIC
low complexity region 94 106 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
low complexity region 183 193 N/A INTRINSIC
coiled coil region 227 272 N/A INTRINSIC
coiled coil region 301 414 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
coiled coil region 523 554 N/A INTRINSIC
low complexity region 580 594 N/A INTRINSIC
Pfam:GTP_EFTU 625 840 4.7e-35 PFAM
Pfam:MMR_HSR1 629 753 5.1e-6 PFAM
Pfam:GTP_EFTU_D2 866 944 7.1e-11 PFAM
Pfam:IF-2 959 1066 1.4e-20 PFAM
Blast:S1 1116 1172 2e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192548
Meta Mutation Damage Score 0.1086 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Accurate initiation of translation in eukaryotes is complex and requires many factors, some of which are composed of multiple subunits. The process is simpler in prokaryotes which have only three initiation factors (IF1, IF2, IF3). Two of these factors are conserved in eukaryotes: the homolog of IF1 is eIF1A and the homolog of IF2 is eIF5B. This gene encodes eIF5B. Factors eIF1A and eIF5B interact on the ribosome along with other initiation factors and GTP to position the initiation methionine tRNA on the start codon of the mRNA so that translation initiates accurately. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik ACAGAGCAGTGCCTACCAG ACAG 5: 138,639,569 probably benign Het
Bcas2 T A 3: 103,172,046 probably null Het
Camk1d A T 2: 5,313,145 I233N probably damaging Het
Chd2 T C 7: 73,501,037 probably null Het
Cnot2 T C 10: 116,499,355 D246G probably benign Het
Cped1 A C 6: 21,986,931 I41L probably benign Het
Dcdc2c A G 12: 28,535,476 V174A probably damaging Het
Dscam G A 16: 96,619,644 R1681C probably damaging Het
Dysf G A 6: 84,190,840 V1755M probably benign Het
Fntb A G 12: 76,916,440 Y399C probably damaging Het
Galns T C 8: 122,611,338 M1V probably null Het
Galnt15 T C 14: 32,040,411 F199L probably damaging Het
Gm8229 A T 14: 44,365,471 H38L unknown Het
Magel2 T C 7: 62,379,999 Y884H unknown Het
Miga1 A T 3: 152,283,831 V473E probably damaging Het
Mrgprx1 C T 7: 48,021,814 V62I possibly damaging Het
Mybl1 G A 1: 9,685,692 P211S possibly damaging Het
Myo19 A G 11: 84,895,308 H254R probably benign Het
Myo1h A G 5: 114,314,956 T6A possibly damaging Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Olfr1475 A T 19: 13,479,430 M256K possibly damaging Het
Olfr44 T C 9: 39,484,318 T309A probably benign Het
Psmd12 A G 11: 107,486,454 E113G possibly damaging Het
Ptpn3 T C 4: 57,195,730 D879G possibly damaging Het
Rufy3 A G 5: 88,637,307 Q414R probably damaging Het
Slc14a2 A G 18: 78,154,102 I813T probably damaging Het
Smok2a G T 17: 13,225,613 A26S probably benign Het
Spsb3 T A 17: 24,891,576 L459Q probably damaging Het
Tacc2 T C 7: 130,623,412 V609A possibly damaging Het
Tmem185b C A 1: 119,526,635 A42E probably damaging Het
Trim56 A G 5: 137,112,616 V682A probably damaging Het
Trim75 T C 8: 64,982,836 K321E possibly damaging Het
Ttc17 A C 2: 94,303,546 M1098R possibly damaging Het
Ydjc C A 16: 17,147,681 H136Q probably damaging Het
Zfp568 A T 7: 30,017,257 H193L probably benign Het
Znhit1 A G 5: 136,982,400 V153A probably benign Het
Other mutations in Eif5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Eif5b APN 1 38041719 missense probably damaging 1.00
IGL01377:Eif5b APN 1 38036098 missense probably benign
IGL01395:Eif5b APN 1 38037258 missense probably damaging 0.96
IGL01572:Eif5b APN 1 38022254 nonsense probably null
IGL01615:Eif5b APN 1 38045706 missense probably damaging 1.00
IGL02141:Eif5b APN 1 38032322 missense probably benign 0.09
IGL02260:Eif5b APN 1 38045456 missense possibly damaging 0.81
IGL02308:Eif5b APN 1 38041747 missense probably damaging 1.00
IGL03180:Eif5b APN 1 38036269 missense probably damaging 1.00
IGL03327:Eif5b APN 1 38041691 splice site probably benign
R0018:Eif5b UTSW 1 38018889 missense unknown
R0036:Eif5b UTSW 1 38019111 missense probably benign 0.23
R0137:Eif5b UTSW 1 38019243 missense probably benign 0.23
R0349:Eif5b UTSW 1 38032366 missense probably benign 0.18
R0606:Eif5b UTSW 1 38048893 missense probably damaging 1.00
R1056:Eif5b UTSW 1 38022167 missense unknown
R1225:Eif5b UTSW 1 38037628 missense probably damaging 1.00
R2043:Eif5b UTSW 1 38041819 missense probably damaging 1.00
R2163:Eif5b UTSW 1 38048794 missense probably benign 0.32
R2225:Eif5b UTSW 1 38019223 missense unknown
R2432:Eif5b UTSW 1 38019342 missense unknown
R2922:Eif5b UTSW 1 38018019 splice site probably benign
R4357:Eif5b UTSW 1 38050258 missense probably damaging 1.00
R4631:Eif5b UTSW 1 38041747 missense probably damaging 1.00
R4665:Eif5b UTSW 1 38045712 missense probably damaging 1.00
R4702:Eif5b UTSW 1 38018877 missense unknown
R4941:Eif5b UTSW 1 38051199 missense probably damaging 1.00
R4995:Eif5b UTSW 1 38051711 makesense probably null
R5020:Eif5b UTSW 1 38019069 nonsense probably null
R5175:Eif5b UTSW 1 38045387 missense probably damaging 1.00
R5375:Eif5b UTSW 1 38045754 missense possibly damaging 0.66
R5566:Eif5b UTSW 1 38045684 missense possibly damaging 0.90
R5566:Eif5b UTSW 1 38051247 missense probably damaging 1.00
R5853:Eif5b UTSW 1 38037307 missense probably damaging 1.00
R5978:Eif5b UTSW 1 37998280 unclassified probably null
R6315:Eif5b UTSW 1 38018033 missense unknown
R6376:Eif5b UTSW 1 38045679 missense probably damaging 0.98
R6388:Eif5b UTSW 1 38019000 missense unknown
R6455:Eif5b UTSW 1 38019027 missense probably benign 0.23
R6810:Eif5b UTSW 1 38046660 missense probably benign 0.45
R6877:Eif5b UTSW 1 38050239 missense probably damaging 1.00
R7130:Eif5b UTSW 1 38041776 missense probably damaging 1.00
R7180:Eif5b UTSW 1 38049074 missense probably damaging 0.98
R7439:Eif5b UTSW 1 38051637 missense probably benign 0.28
R7488:Eif5b UTSW 1 38050306 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- AGGGCGACTGCTGTAATTAGTG -3'
(R):5'- ACACAGCTTGGTCCAACATTAC -3'

Sequencing Primer
(F):5'- GCGACTGCTGTAATTAGTGTAATTTC -3'
(R):5'- GCTTGGTCCAACATTACAAAAACTGG -3'
Posted On2018-05-24