Incidental Mutation 'R6444:Camk1d'
ID519116
Institutional Source Beutler Lab
Gene Symbol Camk1d
Ensembl Gene ENSMUSG00000039145
Gene Namecalcium/calmodulin-dependent protein kinase ID
SynonymsE030025C11Rik, CaMKIdelta, CKLiK, A630059D12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6444 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location5293457-5714515 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5313145 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 233 (I233N)
Ref Sequence ENSEMBL: ENSMUSP00000037028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044009] [ENSMUST00000114987]
Predicted Effect probably damaging
Transcript: ENSMUST00000044009
AA Change: I233N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037028
Gene: ENSMUSG00000039145
AA Change: I233N

DomainStartEndE-ValueType
S_TKc 23 279 5.87e-112 SMART
low complexity region 326 343 N/A INTRINSIC
low complexity region 358 368 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114987
AA Change: I225N

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110638
Gene: ENSMUSG00000039145
AA Change: I225N

DomainStartEndE-ValueType
S_TKc 23 271 1.35e-102 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 350 360 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the calcium/calmodulin-dependent protein kinase 1 family, a subfamily of the serine/threonine kinases. The encoded protein is a component of the calcium-regulated calmodulin-dependent protein kinase cascade. It has been associated with multiple processes including regulation of granulocyte function, activation of CREB-dependent gene transcription, aldosterone synthesis, differentiation and activation of neutrophil cells, and apoptosis of erythroleukemia cells. Alternatively spliced transcript variants encoding different isoforms of this gene have been described. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik ACAGAGCAGTGCCTACCAG ACAG 5: 138,639,569 probably benign Het
Bcas2 T A 3: 103,172,046 probably null Het
Chd2 T C 7: 73,501,037 probably null Het
Cnot2 T C 10: 116,499,355 D246G probably benign Het
Cped1 A C 6: 21,986,931 I41L probably benign Het
Dcdc2c A G 12: 28,535,476 V174A probably damaging Het
Dscam G A 16: 96,619,644 R1681C probably damaging Het
Dysf G A 6: 84,190,840 V1755M probably benign Het
Eif5b G A 1: 38,036,211 D590N probably damaging Het
Fntb A G 12: 76,916,440 Y399C probably damaging Het
Galns T C 8: 122,611,338 M1V probably null Het
Galnt15 T C 14: 32,040,411 F199L probably damaging Het
Gm8229 A T 14: 44,365,471 H38L unknown Het
Magel2 T C 7: 62,379,999 Y884H unknown Het
Miga1 A T 3: 152,283,831 V473E probably damaging Het
Mrgprx1 C T 7: 48,021,814 V62I possibly damaging Het
Mybl1 G A 1: 9,685,692 P211S possibly damaging Het
Myo19 A G 11: 84,895,308 H254R probably benign Het
Myo1h A G 5: 114,314,956 T6A possibly damaging Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Olfr1475 A T 19: 13,479,430 M256K possibly damaging Het
Olfr44 T C 9: 39,484,318 T309A probably benign Het
Psmd12 A G 11: 107,486,454 E113G possibly damaging Het
Ptpn3 T C 4: 57,195,730 D879G possibly damaging Het
Rufy3 A G 5: 88,637,307 Q414R probably damaging Het
Slc14a2 A G 18: 78,154,102 I813T probably damaging Het
Smok2a G T 17: 13,225,613 A26S probably benign Het
Spsb3 T A 17: 24,891,576 L459Q probably damaging Het
Tacc2 T C 7: 130,623,412 V609A possibly damaging Het
Tmem185b C A 1: 119,526,635 A42E probably damaging Het
Trim56 A G 5: 137,112,616 V682A probably damaging Het
Trim75 T C 8: 64,982,836 K321E possibly damaging Het
Ttc17 A C 2: 94,303,546 M1098R possibly damaging Het
Ydjc C A 16: 17,147,681 H136Q probably damaging Het
Zfp568 A T 7: 30,017,257 H193L probably benign Het
Znhit1 A G 5: 136,982,400 V153A probably benign Het
Other mutations in Camk1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Camk1d APN 2 5311073 splice site probably benign
IGL02138:Camk1d APN 2 5445084 nonsense probably null
IGL02826:Camk1d APN 2 5565760 missense possibly damaging 0.56
IGL02999:Camk1d APN 2 5354705 missense probably benign 0.44
R0432:Camk1d UTSW 2 5445135 missense probably damaging 1.00
R1180:Camk1d UTSW 2 5362025 nonsense probably null
R1448:Camk1d UTSW 2 5362025 nonsense probably null
R1628:Camk1d UTSW 2 5311037 missense probably damaging 0.99
R1850:Camk1d UTSW 2 5362015 missense probably benign 0.08
R1998:Camk1d UTSW 2 5362025 nonsense probably null
R2000:Camk1d UTSW 2 5362025 nonsense probably null
R2513:Camk1d UTSW 2 5714236 start codon destroyed probably null 0.15
R4065:Camk1d UTSW 2 5565773 missense probably damaging 1.00
R4201:Camk1d UTSW 2 5354776 missense probably benign 0.03
R4581:Camk1d UTSW 2 5354704 missense probably benign 0.21
R4760:Camk1d UTSW 2 5362056 missense probably damaging 1.00
R4894:Camk1d UTSW 2 5354728 missense probably damaging 1.00
R5001:Camk1d UTSW 2 5313101 missense possibly damaging 0.50
R5394:Camk1d UTSW 2 5303366 missense probably benign 0.10
R5754:Camk1d UTSW 2 5445097 missense probably benign 0.10
R5754:Camk1d UTSW 2 5445099 missense probably damaging 1.00
R5877:Camk1d UTSW 2 5565665 missense probably benign 0.00
R7315:Camk1d UTSW 2 5339230 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCTAAAGATGTAGCTAGCTCAC -3'
(R):5'- ACATTGAGTGTGGGTTCCC -3'

Sequencing Primer
(F):5'- ATCCAGGCTTCAGAACTGTG -3'
(R):5'- CTTAATTTGACTTATGGATCCCATGC -3'
Posted On2018-05-24