Incidental Mutation 'R6444:Rufy3'
ID519120
Institutional Source Beutler Lab
Gene Symbol Rufy3
Ensembl Gene ENSMUSG00000029291
Gene NameRUN and FYVE domain containing 3
SynonymsRpipx, D5Bwg0860e, 2810428M05Rik, 6330416M07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6444 (G1)
Quality Score195.009
Status Validated
Chromosome5
Chromosomal Location88565040-88651392 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88637307 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 414 (Q414R)
Ref Sequence ENSEMBL: ENSMUSP00000143115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031229] [ENSMUST00000196686] [ENSMUST00000196894] [ENSMUST00000198965] [ENSMUST00000199312]
Predicted Effect probably benign
Transcript: ENSMUST00000031229
AA Change: Q396R

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000031229
Gene: ENSMUSG00000029291
AA Change: Q396R

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
RUN 163 225 8.08e-23 SMART
coiled coil region 267 329 N/A INTRINSIC
coiled coil region 357 464 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196686
AA Change: Q414R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143209
Gene: ENSMUSG00000029291
AA Change: Q414R

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
RUN 181 243 8.08e-23 SMART
coiled coil region 285 347 N/A INTRINSIC
coiled coil region 375 482 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196894
AA Change: Q446R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143770
Gene: ENSMUSG00000029291
AA Change: Q446R

DomainStartEndE-ValueType
low complexity region 2 34 N/A INTRINSIC
low complexity region 84 107 N/A INTRINSIC
RUN 213 275 8.08e-23 SMART
coiled coil region 317 379 N/A INTRINSIC
coiled coil region 407 514 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198965
AA Change: Q446R

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143302
Gene: ENSMUSG00000029291
AA Change: Q446R

DomainStartEndE-ValueType
low complexity region 2 34 N/A INTRINSIC
low complexity region 84 107 N/A INTRINSIC
RUN 213 275 2.8e-25 SMART
coiled coil region 317 379 N/A INTRINSIC
coiled coil region 407 555 N/A INTRINSIC
FYVE 597 662 2.9e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000199312
AA Change: Q414R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143115
Gene: ENSMUSG00000029291
AA Change: Q414R

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
RUN 181 243 8.08e-23 SMART
coiled coil region 285 347 N/A INTRINSIC
coiled coil region 375 482 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RPIP8, UNC-14, and NESCA domain-containing protein that is required for maintenance of neuronal polarity. In addition, it has been implicated in mediation of gastric cancer cell migration and invasion via interaction with P21-activated kinase-1, which promotes its expression. The encoded protein localizes to F-actin-enriched invadopodia to induce formation of protrusions, thereby facilitating cell migration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: The gene product is involved in regulating neuronal polarity and axon growth. Homozygous KO leads to loss of neuronal polarity and causes neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik ACAGAGCAGTGCCTACCAG ACAG 5: 138,639,569 probably benign Het
Bcas2 T A 3: 103,172,046 probably null Het
Camk1d A T 2: 5,313,145 I233N probably damaging Het
Chd2 T C 7: 73,501,037 probably null Het
Cnot2 T C 10: 116,499,355 D246G probably benign Het
Cped1 A C 6: 21,986,931 I41L probably benign Het
Dcdc2c A G 12: 28,535,476 V174A probably damaging Het
Dscam G A 16: 96,619,644 R1681C probably damaging Het
Dysf G A 6: 84,190,840 V1755M probably benign Het
Eif5b G A 1: 38,036,211 D590N probably damaging Het
Fntb A G 12: 76,916,440 Y399C probably damaging Het
Galns T C 8: 122,611,338 M1V probably null Het
Galnt15 T C 14: 32,040,411 F199L probably damaging Het
Gm8229 A T 14: 44,365,471 H38L unknown Het
Magel2 T C 7: 62,379,999 Y884H unknown Het
Miga1 A T 3: 152,283,831 V473E probably damaging Het
Mrgprx1 C T 7: 48,021,814 V62I possibly damaging Het
Mybl1 G A 1: 9,685,692 P211S possibly damaging Het
Myo19 A G 11: 84,895,308 H254R probably benign Het
Myo1h A G 5: 114,314,956 T6A possibly damaging Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Olfr1475 A T 19: 13,479,430 M256K possibly damaging Het
Olfr44 T C 9: 39,484,318 T309A probably benign Het
Psmd12 A G 11: 107,486,454 E113G possibly damaging Het
Ptpn3 T C 4: 57,195,730 D879G possibly damaging Het
Slc14a2 A G 18: 78,154,102 I813T probably damaging Het
Smok2a G T 17: 13,225,613 A26S probably benign Het
Spsb3 T A 17: 24,891,576 L459Q probably damaging Het
Tacc2 T C 7: 130,623,412 V609A possibly damaging Het
Tmem185b C A 1: 119,526,635 A42E probably damaging Het
Trim56 A G 5: 137,112,616 V682A probably damaging Het
Trim75 T C 8: 64,982,836 K321E possibly damaging Het
Ttc17 A C 2: 94,303,546 M1098R possibly damaging Het
Ydjc C A 16: 17,147,681 H136Q probably damaging Het
Zfp568 A T 7: 30,017,257 H193L probably benign Het
Znhit1 A G 5: 136,982,400 V153A probably benign Het
Other mutations in Rufy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Rufy3 APN 5 88621350 missense probably damaging 0.96
IGL01964:Rufy3 APN 5 88615070 missense probably damaging 1.00
IGL02537:Rufy3 APN 5 88640662 utr 3 prime probably benign
R0111:Rufy3 UTSW 5 88630584 missense probably damaging 1.00
R0552:Rufy3 UTSW 5 88584270 missense possibly damaging 0.79
R1441:Rufy3 UTSW 5 88632515 missense probably damaging 0.97
R1565:Rufy3 UTSW 5 88640632 missense probably damaging 1.00
R2507:Rufy3 UTSW 5 88649898 missense probably damaging 1.00
R2508:Rufy3 UTSW 5 88649898 missense probably damaging 1.00
R3707:Rufy3 UTSW 5 88643032 missense probably benign 0.28
R4907:Rufy3 UTSW 5 88584192 missense possibly damaging 0.95
R4999:Rufy3 UTSW 5 88637226 missense probably damaging 1.00
R5134:Rufy3 UTSW 5 88645567 missense probably benign 0.01
R5420:Rufy3 UTSW 5 88640659 makesense probably null
R5482:Rufy3 UTSW 5 88637332 frame shift probably null
R6029:Rufy3 UTSW 5 88627255 missense probably damaging 1.00
R6254:Rufy3 UTSW 5 88584309 missense probably benign 0.01
R7219:Rufy3 UTSW 5 88649856 missense probably benign 0.22
R7256:Rufy3 UTSW 5 88614947 missense possibly damaging 0.91
R7327:Rufy3 UTSW 5 88642952 missense probably damaging 0.99
R7352:Rufy3 UTSW 5 88637194 missense possibly damaging 0.92
R7484:Rufy3 UTSW 5 88598472 missense probably benign 0.01
R7645:Rufy3 UTSW 5 88640617 missense probably benign 0.01
R7953:Rufy3 UTSW 5 88642992 missense probably benign 0.01
R8043:Rufy3 UTSW 5 88642992 missense probably benign 0.01
R8478:Rufy3 UTSW 5 88615036 missense probably damaging 1.00
R8549:Rufy3 UTSW 5 88647214 splice site probably null
X0066:Rufy3 UTSW 5 88617418 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ACCCTTTGAGTCTTCTGCCAAAG -3'
(R):5'- GCAGCTGGCTTCCTAAGATG -3'

Sequencing Primer
(F):5'- ACAAGGGCTCTCGTCAGATGTATG -3'
(R):5'- GCTGGCTTCCTAAGATGACATGAC -3'
Posted On2018-05-24